ID: 1063005885

View in Genome Browser
Species Human (GRCh38)
Location 10:1970249-1970271
Sequence AAATCCTGCTTCACAAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063005885_1063005886 10 Left 1063005885 10:1970249-1970271 CCTGTCTTTGTGAAGCAGGATTT No data
Right 1063005886 10:1970282-1970304 CAGCCACCAAAATGAGATTATGG No data
1063005885_1063005890 21 Left 1063005885 10:1970249-1970271 CCTGTCTTTGTGAAGCAGGATTT No data
Right 1063005890 10:1970293-1970315 ATGAGATTATGGAGTAGACTGGG No data
1063005885_1063005889 20 Left 1063005885 10:1970249-1970271 CCTGTCTTTGTGAAGCAGGATTT No data
Right 1063005889 10:1970292-1970314 AATGAGATTATGGAGTAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063005885 Original CRISPR AAATCCTGCTTCACAAAGAC AGG (reversed) Intergenic