ID: 1063006447

View in Genome Browser
Species Human (GRCh38)
Location 10:1975484-1975506
Sequence TTCCATACACAGATGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063006443_1063006447 -8 Left 1063006443 10:1975469-1975491 CCGAGTTGGCCCTATTTCCATAC No data
Right 1063006447 10:1975484-1975506 TTCCATACACAGATGCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063006447 Original CRISPR TTCCATACACAGATGCAGGA AGG Intergenic
No off target data available for this crispr