ID: 1063006627

View in Genome Browser
Species Human (GRCh38)
Location 10:1977694-1977716
Sequence CTTGTGCTCTTATAAGCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063006623_1063006627 24 Left 1063006623 10:1977647-1977669 CCAAGCAGAGGACGATTGCTCTT No data
Right 1063006627 10:1977694-1977716 CTTGTGCTCTTATAAGCCAGAGG No data
1063006622_1063006627 25 Left 1063006622 10:1977646-1977668 CCCAAGCAGAGGACGATTGCTCT No data
Right 1063006627 10:1977694-1977716 CTTGTGCTCTTATAAGCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063006627 Original CRISPR CTTGTGCTCTTATAAGCCAG AGG Intergenic
No off target data available for this crispr