ID: 1063010000

View in Genome Browser
Species Human (GRCh38)
Location 10:2012377-2012399
Sequence CAGGGAATGGAGGGTGTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 264}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063009994_1063010000 -6 Left 1063009994 10:2012360-2012382 CCTGCTGTTCCTGCCTGCAGGGA 0: 1
1: 0
2: 7
3: 37
4: 413
Right 1063010000 10:2012377-2012399 CAGGGAATGGAGGGTGTTTCTGG 0: 1
1: 0
2: 1
3: 36
4: 264
1063009990_1063010000 22 Left 1063009990 10:2012332-2012354 CCCAAAGCTGGCAGGCAGAGGAG 0: 1
1: 0
2: 4
3: 37
4: 387
Right 1063010000 10:2012377-2012399 CAGGGAATGGAGGGTGTTTCTGG 0: 1
1: 0
2: 1
3: 36
4: 264
1063009991_1063010000 21 Left 1063009991 10:2012333-2012355 CCAAAGCTGGCAGGCAGAGGAGC 0: 1
1: 1
2: 4
3: 64
4: 1131
Right 1063010000 10:2012377-2012399 CAGGGAATGGAGGGTGTTTCTGG 0: 1
1: 0
2: 1
3: 36
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063010000 Original CRISPR CAGGGAATGGAGGGTGTTTC TGG Intergenic
901078473 1:6570244-6570266 TAGGGAGTGGGGGCTGTTTCTGG + Intronic
903232582 1:21931085-21931107 AAGGGAAGGGAGAGTGGTTCTGG + Intronic
904439973 1:30523980-30524002 TAGGGAATGGAGAGTGTTTGGGG + Intergenic
905683683 1:39893327-39893349 GGGGGAAGGGAGGGTGTTTCTGG - Intergenic
906117512 1:43366422-43366444 CAGGGGGTGGAGGGTGGGTCCGG + Intronic
906842249 1:49152234-49152256 CAGGGAAAGGAGGGTTTGTGTGG - Intronic
908509479 1:64840064-64840086 CAGGAAATGAAGGTTATTTCTGG + Intronic
908931264 1:69318403-69318425 GAGGGAATGGAAGGTATTTCAGG + Intergenic
909881860 1:80889738-80889760 CAGGGAATGGTAGGTAATTCTGG + Intergenic
911062309 1:93758937-93758959 CAGGGAATGGTGGAAGGTTCTGG + Intronic
911224620 1:95291532-95291554 GAGGGATTGGAGGTTGTTTGGGG + Intergenic
912526534 1:110287599-110287621 GAGGGAATGGTGGGGGTGTCTGG + Intergenic
912905137 1:113697554-113697576 AAGCGAATGAATGGTGTTTCCGG - Exonic
914865820 1:151427911-151427933 CAGGGAAGGGATGGTGTTAAGGG + Exonic
915730049 1:158046893-158046915 CAGAGCATGGAGGGGGTTGCTGG + Intronic
917726167 1:177829270-177829292 GAGGGAATGGAGAGTTTTTGGGG + Intergenic
919982466 1:202650877-202650899 CAAGGAAAGGCGGGTGTTTCAGG + Intronic
921544821 1:216462063-216462085 CAAGGAATGGATTTTGTTTCTGG + Intergenic
923807416 1:237273010-237273032 CCGGGGCTGGAGGGTGTTTTGGG + Intronic
924947773 1:248857749-248857771 CTTTGAAAGGAGGGTGTTTCTGG + Intronic
1063010000 10:2012377-2012399 CAGGGAATGGAGGGTGTTTCTGG + Intergenic
1064612149 10:17114740-17114762 CAGGGCATGGAGGGTCGTTCTGG + Intronic
1065632502 10:27694911-27694933 CAAGGAATGGAGGGTTTTCCTGG - Intronic
1065815338 10:29478147-29478169 TAGGGAATTGAGTGTGTTTCGGG - Intronic
1066075560 10:31872293-31872315 CGGGGAGAGGAGGGTGTTTGAGG - Intronic
1068151693 10:53140510-53140532 CAGGAAACGGAGTTTGTTTCAGG - Intergenic
1068955620 10:62817147-62817169 CAGAGGAAGGAGGGTGTCTCCGG - Intronic
1069611411 10:69775033-69775055 CAGGGAAGGGAGTGTATTTGTGG - Intergenic
1069838964 10:71327435-71327457 CAGGCAATGGCGGCTGTTGCAGG - Intronic
1072165388 10:92808011-92808033 AAGGGAATGGAGGTTCTTTTTGG + Intergenic
1075187456 10:120275911-120275933 CAGGGAATGGAGGTTATTTATGG + Intergenic
1078924436 11:15861263-15861285 CAGAGAAGGAAGGGTATTTCAGG - Intergenic
1079445243 11:20551223-20551245 CAATGACTGGAGGTTGTTTCTGG - Intergenic
1079460183 11:20671495-20671517 CACGGAATGGAACGTGTTTCAGG + Intronic
1081400375 11:42636087-42636109 CAGGGTGTGGGGGGTGTTGCAGG + Intergenic
1081674373 11:44960052-44960074 CAGGGATTGGAGGGAGCTACTGG - Intergenic
1083398908 11:62410753-62410775 CAGGGAGTACAGGGTGATTCAGG - Intronic
1083480311 11:62940210-62940232 CAGGTAATGGCAGGTGTTACAGG - Intronic
1084376571 11:68782274-68782296 GAGGGGAGGGAGGGTGTGTCAGG - Intronic
1084492033 11:69484111-69484133 CAGGGAAGGGAGGGTGCTCTTGG + Intergenic
1084961609 11:72719862-72719884 CAGGCAGGGGAGGGTGTTCCAGG - Intronic
1086390859 11:86361269-86361291 CTGGGAATGGACAGTATTTCAGG + Intergenic
1086454580 11:86948486-86948508 CAGACAATGGAGAGTGTTTATGG - Exonic
1088448672 11:109959651-109959673 CAGGGAATAGAGGGTATGACAGG - Intergenic
1088537047 11:110872669-110872691 CAGAGGATGCAGGGTGTGTCTGG - Intergenic
1089209166 11:116789069-116789091 CATGGAATGCAGGCTGTGTCTGG - Intergenic
1089331082 11:117689500-117689522 CAGGGTATGAAACGTGTTTCTGG + Intronic
1089634535 11:119803863-119803885 CAGGGAAGGAAAGGTGTTTCTGG - Intergenic
1090962581 11:131570337-131570359 CAAGGAATGGAGAATGTTCCTGG - Intronic
1091049860 11:132357593-132357615 CAGGGGATTGGGAGTGTTTCAGG + Intergenic
1091367328 11:135033088-135033110 CATGGACAGGAGGGTGTTTTTGG + Intergenic
1091888726 12:4035761-4035783 CAGGGAAAGGAGAGTATCTCAGG - Intergenic
1092078543 12:5693642-5693664 CAGGGTATTGAGGGGGTCTCTGG - Intronic
1094110250 12:26854544-26854566 CAAGGAATTGAGGATGATTCAGG - Intergenic
1094473662 12:30825203-30825225 GAGGGAAGGGAGGGTCTTTCTGG + Intergenic
1095814732 12:46408706-46408728 CTGGGAAAGGAGGCTTTTTCAGG + Intergenic
1096007516 12:48184570-48184592 CAGTGACTGGAGGGTGTGGCGGG - Exonic
1096404526 12:51333812-51333834 CAGGGATTTGAGAGTATTTCAGG + Intronic
1097008548 12:55936275-55936297 CAGGGAAAGGAAGATGTTTAGGG + Intronic
1097497844 12:60364562-60364584 GACAGAAGGGAGGGTGTTTCTGG + Intergenic
1098805923 12:75020128-75020150 CAGGGAGTGGGGAGTGTGTCAGG + Intergenic
1100661863 12:96708134-96708156 CAGGGAGTTGAGGGTGTATATGG + Intronic
1102309791 12:111835923-111835945 CAGGGAGTGGGGGGAGGTTCAGG - Intergenic
1102451067 12:113042528-113042550 AAGGGACTGGAGGGTGCTGCTGG + Intergenic
1102688523 12:114742480-114742502 CAGGGTCTGGAGGGTGATGCAGG + Intergenic
1102959531 12:117083725-117083747 CAGGGGCTGGAGGGTGTTGAGGG + Intronic
1103167757 12:118784833-118784855 CAGGGAAGGAGTGGTGTTTCTGG + Intergenic
1103732853 12:123039569-123039591 CAGAGAATGGAGGATTTTTAGGG + Intronic
1105701889 13:22940395-22940417 CAGGGACTGGGGGGTGATTGGGG - Intergenic
1107113120 13:36719117-36719139 TAGGGAGTGGAGAGTGGTTCAGG - Intergenic
1109277934 13:60322796-60322818 CTGGGCAGGGAGGGTGTTCCTGG - Intergenic
1111898166 13:94167639-94167661 GAGGGAAGGGAGAGTGTTCCAGG + Intronic
1112911943 13:104496308-104496330 CAGGGAATGGTCGTTGTTACTGG + Intergenic
1115369368 14:32594629-32594651 CTGAGAATGGAGAGTGGTTCTGG + Intronic
1117271014 14:54143433-54143455 GAGGGAACTAAGGGTGTTTCTGG + Intergenic
1121865932 14:97362758-97362780 CAGAGAAGGAAGGGTGTTTCTGG - Intergenic
1122153308 14:99736102-99736124 AAGGGAATAGAGGGTGTTCTAGG - Intergenic
1122873677 14:104653009-104653031 CAGAGCATGGAGGGTGTTTACGG + Intergenic
1122905114 14:104798046-104798068 CAGGGAAGGGGGGCTGTTCCAGG - Intergenic
1123802910 15:23840115-23840137 CAGGGAATGGAGAGAGAATCAGG + Intergenic
1124337562 15:28868711-28868733 CAGGGAGTGGAGGGTGATGCTGG - Intergenic
1124637682 15:31375330-31375352 AAGAAAATGGAGGCTGTTTCAGG - Exonic
1124803359 15:32856958-32856980 CATGGAATGAAGGATGTTTCAGG + Intronic
1126670875 15:51113947-51113969 CAGGGCATGTAGAGTGTTACAGG - Intergenic
1127819600 15:62643557-62643579 CATGGAATGGAGGGTAGTTCAGG - Intronic
1127846911 15:62878160-62878182 CTGGCAATGGCAGGTGTTTCTGG - Intergenic
1127903050 15:63355236-63355258 CAGCGAGGGGAGGGTGTTTCAGG - Intronic
1128244860 15:66126200-66126222 CAGGGACCGGGGTGTGTTTCTGG + Intronic
1128326552 15:66727568-66727590 CTGGGAATGGGGAGTGATTCTGG + Intronic
1128363979 15:66983742-66983764 CTGGGGATGGAGGCTGTTCCAGG - Intergenic
1129445279 15:75612742-75612764 AAGGGAAGGGTAGGTGTTTCAGG - Intronic
1129457795 15:75684945-75684967 CAGGGCATGAAGGGTGCTGCTGG - Intronic
1129892422 15:79080236-79080258 GAGGGAAGGGCTGGTGTTTCAGG - Intronic
1131053121 15:89360891-89360913 CAGTGAGTGGAGGGGGTGTCTGG + Intergenic
1131549898 15:93348298-93348320 CAGTGAATGGTGGGTATTTCTGG + Intergenic
1133652806 16:7828993-7829015 CAGGGAGTGGTGGGTGGTTTTGG + Intergenic
1136559629 16:31031471-31031493 GAGGGAATGCAGGGTTTTTCCGG - Intergenic
1138183533 16:54959515-54959537 CAGGGATGGGAGGGTGGCTCTGG - Intergenic
1138460591 16:57145535-57145557 TAGGGAATGGAGGGGGTCACAGG + Intronic
1138663915 16:58546590-58546612 CAGTGAAGGCAGGGTATTTCGGG - Intronic
1139842883 16:69895966-69895988 CATGGAATAGTGTGTGTTTCTGG + Intronic
1140340079 16:74149382-74149404 CTGGGATTGGAGGGGGTTTGTGG + Intergenic
1142611840 17:1112840-1112862 GAGGGAATGGAGGGTGGGTGTGG - Intronic
1143347202 17:6258538-6258560 CAGGGAGAGGAGGCTGTTGCTGG + Intergenic
1143482770 17:7237103-7237125 CTGTGAATGGAAGGTGTTTATGG - Intronic
1143615124 17:8045133-8045155 CTGGGAGAGGAGTGTGTTTCGGG - Intronic
1144029591 17:11307582-11307604 TGGGGAATGGAGTGTGTGTCTGG + Intronic
1144656580 17:17041261-17041283 CAGGGAATGGAGGAGGTTTTAGG - Intergenic
1145817469 17:27805890-27805912 CAGGGAAGGGAGGGTGTTCTGGG - Intronic
1146582285 17:34049426-34049448 CAGGGAATGCAGCCTGTTCCTGG - Intronic
1146697042 17:34917275-34917297 CAAAGAATGGAGGGTGGTACTGG + Intergenic
1151106762 17:71624320-71624342 CAAGGAATGCAGGGGGCTTCTGG + Intergenic
1151113602 17:71707162-71707184 CAGAGGAAGGAGGGTCTTTCTGG - Intergenic
1152284845 17:79406415-79406437 CACGGAGTGGAGGGTGTTGCAGG - Intronic
1152589990 17:81206911-81206933 CAGGGAAGGGATGGGGTGTCTGG - Intronic
1152604315 17:81281381-81281403 CAGAGAATGGAGGGTGTGCTGGG + Intronic
1153126370 18:1796613-1796635 CAGAGCATGGAGTGTGTTTTGGG - Intergenic
1155060527 18:22224170-22224192 GAGGGAGTGGAGGGCGTTTCAGG - Intergenic
1155877116 18:31101683-31101705 AAGGGAAGGGAAGGTGTCTCCGG - Intronic
1156157331 18:34318799-34318821 CAGGGAATTGTGTGTGTTTGTGG - Intergenic
1156353959 18:36325186-36325208 CAGGGAGTGGTGGGGGTCTCTGG + Intronic
1161192782 19:2968401-2968423 CAGGGGATGGAGGGGGCTTTTGG - Intergenic
1162660247 19:12163198-12163220 CAGGAAATGGTGAGTGTGTCGGG + Exonic
1162804152 19:13128215-13128237 CAGTGAATAGATGGTGCTTCAGG + Intronic
1163051765 19:14689862-14689884 CAGAGCATGGAGGGTGGTGCTGG - Intronic
1163054018 19:14705256-14705278 GAGGGAAAGGAGGGTGTTTGGGG + Intronic
1163129770 19:15265240-15265262 CGGGCACTGGTGGGTGTTTCTGG - Intronic
1163528532 19:17835886-17835908 CTGGGAATGGAGGGTGGAGCAGG + Intronic
1163739170 19:19000088-19000110 CAGGGAAGGGAGGGTACCTCTGG - Intronic
1166409381 19:42546698-42546720 CAGTGAGTGGTGGGTGTTCCAGG + Intronic
1167214361 19:48154558-48154580 CAGGGAACAGAGGGTGATTCAGG - Intronic
1167241847 19:48348475-48348497 CAGGGGATGGTGTGTGTTACAGG - Intronic
1167462981 19:49636097-49636119 CAGGGAAGTCAGGGTGTTCCCGG + Intronic
1167476772 19:49705987-49706009 CGGGGAAAGCAGGCTGTTTCGGG - Exonic
1167619777 19:50554333-50554355 CAGGGCATGGAGGGTGACCCGGG - Intronic
1167664081 19:50813139-50813161 TAGGTAATGGCTGGTGTTTCTGG + Intergenic
1168281673 19:55309133-55309155 TTGGGACTGAAGGGTGTTTCTGG + Intronic
1168338621 19:55611360-55611382 CAGGGAATAGGGGGTGATTTAGG - Intronic
925555310 2:5124382-5124404 CAGAAAATGGAGGGCCTTTCAGG - Intergenic
925583375 2:5437533-5437555 CAAGGAAGGGAGGGTGTCTGAGG - Intergenic
925636502 2:5946389-5946411 CAGAGGATGGAGGCTGGTTCAGG - Intergenic
925869839 2:8260466-8260488 CAGGGAAGGGAAGGTGCTGCTGG - Intergenic
926019508 2:9482906-9482928 CAGGGAAGGGGAGGTGTTTAAGG + Intronic
929292397 2:40208472-40208494 GAGGGAATGGAGAGAGATTCTGG + Intronic
929300256 2:40295944-40295966 CAAGGAAAGGAGGGTGTTGGTGG + Intronic
929472559 2:42210031-42210053 AAGGGAATGGGGGGTGTGTGTGG - Intronic
933920693 2:87042024-87042046 CAGGGAATGGAGACTGGTCCAGG + Intergenic
933930932 2:87151762-87151784 CAGGGAATGGAGACTGGTCCAGG - Intergenic
934002305 2:87727874-87727896 CAGGGAATGGAGACTGGTCCAGG - Intergenic
935346246 2:102111114-102111136 CAGAGCATGGTGGGTGTTTAGGG + Intronic
935685497 2:105679359-105679381 CAGGGAATGGTGGGTGCTCAGGG - Intergenic
936362191 2:111813681-111813703 CAGGGAATGGAGACTGGTCCAGG + Intronic
936508152 2:113124478-113124500 CTGGGAAAGGAGGGTGGGTCAGG + Intronic
936511956 2:113155828-113155850 GTGGGAGTGGATGGTGTTTCAGG - Intergenic
937857449 2:126682803-126682825 TAGGGACTGGAGGGGGTGTCTGG - Intronic
938716218 2:134024335-134024357 AAGGGATTGGAGGGTGTGTGTGG - Intergenic
940799434 2:158117112-158117134 TACAGAATGGAGGATGTTTCTGG + Intronic
942042719 2:172081539-172081561 AAGGGAAAGGAGGGTGCTCCGGG - Exonic
943441253 2:187931279-187931301 CAGGGAATGGAGACTGGTCCAGG - Intergenic
943831401 2:192467374-192467396 AAGGAAGTGGAGGTTGTTTCTGG + Intergenic
943982193 2:194568465-194568487 CAAGAAATGGAAAGTGTTTCGGG - Intergenic
945042560 2:205754533-205754555 CAGAGAAGGGAGGGTGATTAAGG - Intronic
946153692 2:217793300-217793322 GAGGGAAGAAAGGGTGTTTCAGG - Intergenic
946243675 2:218372832-218372854 AAGGGTATAGAGGCTGTTTCAGG + Intergenic
947576242 2:231277163-231277185 CAGGGAAAAGAGTGTGATTCAGG - Intronic
948415500 2:237799626-237799648 AATGGAAAGGAGGGTGTATCTGG + Intronic
948805504 2:240452153-240452175 CAGGGAGGGGAGGGTGTTGGCGG + Intronic
1168992100 20:2103486-2103508 CCAGGAAAGGAGGGTGTGTCAGG - Intronic
1172112472 20:32555144-32555166 CAGGAAAGAAAGGGTGTTTCAGG - Intronic
1172807227 20:37621044-37621066 AAGGGAAGGGAGGGTGTACCAGG + Intergenic
1173417288 20:42868166-42868188 CAGAGTATTAAGGGTGTTTCTGG + Intronic
1173941272 20:46913387-46913409 CAGATAATGTAGGGTGTTTGAGG + Intronic
1175189251 20:57199999-57200021 CAAGGAATGGAGAGGGTCTCAGG + Intronic
1175262378 20:57682669-57682691 CAGGGAGTGGGTGCTGTTTCAGG - Intronic
1177144878 21:17396769-17396791 CAGTCAATGGAGGGTTTATCTGG - Intergenic
1179379018 21:40881287-40881309 GAGGGAAAGGAGGGAATTTCTGG - Intergenic
1179786892 21:43735302-43735324 CAGGGTGTTGAGTGTGTTTCTGG + Intronic
1180042504 21:45287600-45287622 CACGGGATGGAGGGTGGTCCGGG - Intronic
1183054259 22:35292989-35293011 CAGGGTATGGTGGCTGTGTCTGG + Exonic
1184694373 22:46131431-46131453 AAGGGCAGGAAGGGTGTTTCGGG + Intergenic
1184806647 22:46798879-46798901 CAGGGCAGGGAGAGGGTTTCCGG + Intronic
949502786 3:4697804-4697826 CAGGGAAGAGAGGTTATTTCTGG + Intronic
949643444 3:6066514-6066536 AAGGGAAAGGTGGTTGTTTCTGG - Intergenic
950215068 3:11153529-11153551 CAGGGAGAGGAGGGTGTTTGAGG - Intronic
952178345 3:30891486-30891508 CAGGCAAAGGAGGCTGTTCCAGG + Intronic
953877624 3:46675316-46675338 CAGGGAGAGGAGGGTGCCTCGGG + Intronic
955559527 3:60173645-60173667 CATGAAATGGTGGATGTTTCCGG + Intronic
956174837 3:66463035-66463057 CAGGGAGTGGGGGGTGTTACTGG + Intronic
960584478 3:119308438-119308460 CAAGGAATGTAGGTGGTTTCTGG - Intronic
960611369 3:119557874-119557896 CAGAGATTGGAGGGTGTTCCTGG + Exonic
961866063 3:129954405-129954427 CAGAGAAAGGAAGGTGGTTCAGG - Intergenic
967982276 3:195072814-195072836 AAGGGAATGGTGGGTTTCTCTGG + Intronic
968066046 3:195760347-195760369 CAGGGAAGGAAGGGTATTCCAGG + Intronic
969167669 4:5330816-5330838 CAGGGAATGGAGGGAATGTTTGG + Intronic
969216973 4:5730731-5730753 CAACAAATGGGGGGTGTTTCAGG + Intronic
970244596 4:14046650-14046672 CAGGGAATGTAGTGTCTGTCTGG - Intergenic
970266520 4:14293972-14293994 CAGTGGAGGGAGGGTGTTTCAGG - Intergenic
972440343 4:39082879-39082901 CAGGCAAGGGAGGGTGTTATGGG + Intronic
973773358 4:54225953-54225975 AAGGGAACGGGGGATGTTTCTGG - Intronic
973931424 4:55796419-55796441 AAAGGACTGAAGGGTGTTTCAGG - Intergenic
975421349 4:74167660-74167682 AAGGGAAGGAAGAGTGTTTCAGG + Intronic
975696009 4:77013795-77013817 CAGGGAACAGAGAGTCTTTCGGG - Intronic
976435736 4:85015870-85015892 CAGGGAATCGGGGGTGGGTCAGG - Intergenic
977610659 4:99026645-99026667 CAGAGAATGGATAGTCTTTCAGG + Intronic
977921051 4:102642829-102642851 CAGGGGTTGGGGTGTGTTTCTGG - Intronic
979318208 4:119292101-119292123 CTGGTAATGATGGGTGTTTCTGG + Intronic
981784764 4:148464771-148464793 AGGAGAATGGAGGGTGTTTTAGG + Intergenic
981784870 4:148465805-148465827 AGGAGAGTGGAGGGTGTTTCAGG - Intergenic
982141032 4:152318253-152318275 CATGGAATAGAGGGAGTTACAGG + Intergenic
985341520 4:188959682-188959704 TAGAGCATGGAGGGTGTTGCAGG - Intergenic
986525682 5:8672432-8672454 CAGACAATGGAGGATTTTTCAGG + Intergenic
986714350 5:10511940-10511962 CTGGGAATTGAGGGGGTTTCTGG - Intronic
986739847 5:10696322-10696344 CAGGGAATAGGGGGTGTGGCGGG + Intronic
990368623 5:55094635-55094657 CAGGGAAGGGAGTGTCCTTCAGG - Intergenic
990575844 5:57122726-57122748 CAGGAAATGCCAGGTGTTTCAGG + Intergenic
992494995 5:77283234-77283256 CAGGGAGTGGGGGGTGGTGCAGG - Intronic
992587013 5:78251502-78251524 CATGGTATGGAGGGTATCTCTGG + Intronic
993701474 5:91123873-91123895 CAGGGAGTGGAGGGTGGGTGAGG + Intronic
996105656 5:119499331-119499353 AAGAAAATGGAGGGAGTTTCTGG - Exonic
996247857 5:121287073-121287095 CAAGGAGTGGGGGTTGTTTCGGG - Intergenic
996282345 5:121745773-121745795 CAGGGAATGAAGCATGTTTGGGG + Intergenic
997522173 5:134529968-134529990 CAGGCAATGGCTGGTGTTGCAGG + Intronic
997821254 5:137068146-137068168 AAGTGAATGGAGGGGGTTCCTGG - Intronic
998020692 5:138767454-138767476 GAGGGCAGGGAGGCTGTTTCAGG - Intronic
998057754 5:139093491-139093513 CAGGGTATGGAGATTGTGTCAGG - Intronic
1000343580 5:160295889-160295911 CAGGAAATAGAGGGTGTATTAGG - Intronic
1001045556 5:168368833-168368855 CAGGGCATGGAGGGTGGTGGCGG + Intronic
1001422160 5:171596343-171596365 CAGGGAAGGCAAGGGGTTTCTGG + Intergenic
1003013814 6:2451907-2451929 TAAGGGATGGAGGGTTTTTCAGG + Intergenic
1006399848 6:33811011-33811033 CAGGGAATGGAAGGTGAGACTGG - Intergenic
1006798720 6:36746223-36746245 CAGGGAAGGGAGTGGATTTCTGG + Intronic
1006892324 6:37439522-37439544 CAGGAAAGCGATGGTGTTTCAGG - Intronic
1007102678 6:39260935-39260957 CAGGGAATGGAGGGGGCTTCAGG - Intergenic
1008665244 6:53709585-53709607 TAGGGGGTGGAGGGGGTTTCAGG - Intergenic
1010450101 6:75992757-75992779 CAGAGACTGGAGTGAGTTTCAGG - Intronic
1010651276 6:78457988-78458010 CAGGAAAAGAAGAGTGTTTCAGG + Intergenic
1012603881 6:101132884-101132906 GAGGGCAAGGAGGGAGTTTCTGG + Intergenic
1012798166 6:103790223-103790245 CAGGGAATGAAGGCTGCCTCTGG + Intergenic
1013444451 6:110208460-110208482 AAGGAGAAGGAGGGTGTTTCTGG - Intronic
1015235528 6:130966596-130966618 TGGGGAATGGAGGGTGGTGCTGG + Intronic
1015867397 6:137741007-137741029 CAGGTAATGGAGAGTGATTTGGG + Intergenic
1016367975 6:143339493-143339515 GAGGGAATAGGGGGTGTGTCAGG + Intronic
1017855047 6:158343386-158343408 AAGGGAATGGTGAGTGTTACGGG + Intronic
1018872037 6:167790649-167790671 GAGGGAATGAAGGGTTTTTTTGG + Intronic
1019042990 6:169121456-169121478 CAGGGAATGGAGGCTACTTTGGG + Intergenic
1019164924 6:170091735-170091757 CAGGGCATGGATGGGGTTTCCGG - Intergenic
1019524212 7:1473492-1473514 CGGGGTCTGGAGGGTGTTCCTGG - Intronic
1020176523 7:5886502-5886524 CAGGTTTTGGAGGGTGTTTTTGG + Intergenic
1021738730 7:23664166-23664188 CTGGAAATGGAGGGGATTTCAGG + Intergenic
1022042460 7:26593442-26593464 AAGGGAATGGACGGTGGCTCTGG - Intergenic
1023625234 7:42108921-42108943 CAGGGGTGGGAGGGTGTTTCAGG - Intronic
1024774762 7:52771130-52771152 CAGAGAAAGGAGGGTGGTTTGGG + Intergenic
1026079727 7:67207035-67207057 TAGGGAAAGGAGGGCGTTTCTGG - Intronic
1026325905 7:69310247-69310269 CAGGGGATGGAGGATTTTTAGGG + Intergenic
1026451152 7:70530718-70530740 CAGGGGAGGGGGGATGTTTCTGG + Intronic
1027161291 7:75804383-75804405 CAGGGATTGGAGGGTATTTTTGG + Intergenic
1027219731 7:76206305-76206327 AAGGGAAGGGAAGGTGTTTGGGG + Intronic
1027723169 7:81770232-81770254 CGGGGAATGGGGGGGGTTGCAGG - Intronic
1029082309 7:97984524-97984546 CAGGTTTTGGAGGGTGTTTTTGG - Intergenic
1032185272 7:129719803-129719825 CGGAGAATGGGGGGTGTTACTGG - Intronic
1032954156 7:136951090-136951112 CAGGGAATGGAGGCCATGTCGGG - Intronic
1034497535 7:151431577-151431599 GTGGGAATGGAGGGGCTTTCGGG - Intronic
1036452996 8:8884806-8884828 CAGGCATGGTAGGGTGTTTCTGG + Intronic
1037893579 8:22637029-22637051 CAGGGTGTGGAGAGAGTTTCAGG - Intronic
1038308057 8:26422275-26422297 AAGGGTATGGAGGGAGCTTCTGG - Intronic
1038711239 8:29948387-29948409 CATGTCATGGAGGGTGTTTTAGG + Intergenic
1039680475 8:39730210-39730232 CATGGAATGGGGGCTGCTTCTGG - Intergenic
1043655735 8:82662948-82662970 CAGGAAGCGGAGGGTGTTTCAGG + Intergenic
1044667389 8:94643577-94643599 CTGGAAATGGATGGTGTTTATGG + Intronic
1048008601 8:130438894-130438916 CTGGGAAAGAAGGGTGTTACGGG - Intronic
1049270550 8:141693394-141693416 CAGGGAATGCAGGAAGGTTCTGG + Intergenic
1049466008 8:142751606-142751628 CATGGAATGCAGGGTGTGCCAGG + Intronic
1050530506 9:6584704-6584726 AAAGGAATGAAGGATGTTTCTGG - Intronic
1050576680 9:7003907-7003929 CAGGGAATGGGGGGTGTAGTGGG - Intronic
1052077155 9:24157280-24157302 CAGGGAATGCAGGCAGTCTCTGG + Intergenic
1055466724 9:76573945-76573967 CAGGGTAAGGAGGGTGTGTGAGG - Intergenic
1055689716 9:78816459-78816481 CAGGGGATAGAGTGTGTTCCTGG + Intergenic
1056213838 9:84390094-84390116 CAGGGGAAGGAGGGTGGTTGGGG + Intergenic
1058779178 9:108316383-108316405 AAGAGAAGGGAGGGTGATTCAGG - Intergenic
1058828719 9:108796748-108796770 CAGGGAATGGAGACTAGTTCAGG + Intergenic
1059721008 9:116960085-116960107 CAGGGAGGGCAGGGTGTCTCTGG + Intronic
1060995514 9:127873253-127873275 CAGGGAAGAGAGGGTGCTCCAGG + Intronic
1061180290 9:129021547-129021569 CGGGGAAAGGAGGGTGGCTCCGG - Intronic
1061542005 9:131282700-131282722 GGGGGAGTGGAGGGTGTTGCGGG - Intergenic
1061716593 9:132522113-132522135 CAGGGGATGGGGGCTGTTGCAGG + Intronic
1061897262 9:133654944-133654966 CAGGGATGGGAGGGTCTTGCCGG + Intronic
1061904540 9:133689950-133689972 CTTGTCATGGAGGGTGTTTCCGG + Intronic
1062348944 9:136129454-136129476 GCGGGATGGGAGGGTGTTTCCGG - Intergenic
1186426461 X:9466604-9466626 CAGGGACTGGGCGATGTTTCAGG - Intronic
1187226864 X:17381420-17381442 AAGGGAGGGGAGGATGTTTCAGG - Intronic
1187337086 X:18390853-18390875 CAGTGAGTGGAGTCTGTTTCAGG - Intergenic
1189482061 X:41399716-41399738 TAAGGAATGAATGGTGTTTCTGG - Intergenic
1190298820 X:49044015-49044037 CAGCGAAAGGGGGGGGTTTCTGG - Intergenic
1194103609 X:89738699-89738721 TAGGGAATGGAGGGCATTTCAGG + Intergenic
1194278781 X:91921431-91921453 CAGAGAATGGAGGATTTTTATGG - Intronic
1196323139 X:114368218-114368240 GAGGGAGTGGAGGATGTCTCTGG + Intergenic
1196323524 X:114372471-114372493 GAGGGAGTGGAGGATGTCTCTGG - Intergenic
1196865239 X:120065356-120065378 CATGGTGTGGAGAGTGTTTCTGG + Intergenic
1196877854 X:120170924-120170946 CATGGTGTGGAGAGTGTTTCTGG - Intergenic
1200596264 Y:5144933-5144955 CAGAGAATGGAGGATTTTTATGG - Intronic
1201337146 Y:12893262-12893284 CTGGGAATGGAGGCTTGTTCAGG + Intergenic
1201604558 Y:15770970-15770992 CGGGGAAAGGAGGGTGGCTCCGG + Intergenic