ID: 1063010067

View in Genome Browser
Species Human (GRCh38)
Location 10:2012735-2012757
Sequence CAGCAAAGGCAGCCCAGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 340}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063010067_1063010073 11 Left 1063010067 10:2012735-2012757 CCTGTCCTGGGCTGCCTTTGCTG 0: 1
1: 0
2: 1
3: 27
4: 340
Right 1063010073 10:2012769-2012791 GGGCCTCCTTCACAACTAAATGG 0: 1
1: 0
2: 0
3: 13
4: 68
1063010067_1063010070 -10 Left 1063010067 10:2012735-2012757 CCTGTCCTGGGCTGCCTTTGCTG 0: 1
1: 0
2: 1
3: 27
4: 340
Right 1063010070 10:2012748-2012770 GCCTTTGCTGGTATTTGCGAAGG 0: 1
1: 0
2: 1
3: 6
4: 99
1063010067_1063010072 -9 Left 1063010067 10:2012735-2012757 CCTGTCCTGGGCTGCCTTTGCTG 0: 1
1: 0
2: 1
3: 27
4: 340
Right 1063010072 10:2012749-2012771 CCTTTGCTGGTATTTGCGAAGGG 0: 1
1: 0
2: 1
3: 4
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063010067 Original CRISPR CAGCAAAGGCAGCCCAGGAC AGG (reversed) Intergenic
900555108 1:3276437-3276459 CAGCAGAGGCAGCTCAGGGCCGG - Intronic
901434709 1:9240072-9240094 CAGTGAAGGGTGCCCAGGACTGG + Intronic
901612510 1:10510024-10510046 CAGGGAAGGCAGCCCAGGGATGG + Intronic
901663409 1:10813083-10813105 CAGCACTGGCAGCCAAGGGCTGG + Intergenic
901724598 1:11230961-11230983 CAGCAGAGGCATCCCGGGACTGG + Exonic
902595126 1:17504310-17504332 CAGCAAAGGTCGGCCAGGTCCGG + Intergenic
904537440 1:31209077-31209099 CAAGAAATGCAGCCCAGGGCTGG + Intronic
904938693 1:34149851-34149873 CTGCAAAGGTAGCCCAGGTGTGG + Intronic
905028577 1:34866918-34866940 CAGCAAGGGCAGCCTTGGACAGG - Intronic
905853494 1:41291304-41291326 CTGCAGAGCCAGCCCAGGTCTGG + Intergenic
906545094 1:46614867-46614889 CCACAAAGGCAGGCCAGGATGGG + Intronic
912475615 1:109932814-109932836 CAGCACATGAAGCCCAGGAAAGG - Intergenic
915380831 1:155438630-155438652 CTTCAAAGGCAGGCCAGGACAGG - Exonic
916648781 1:166816235-166816257 CAGCAGAGGAAGCCCTGGAGAGG + Intergenic
917975531 1:180235300-180235322 CAGCAAAGGGGTCCCAGGCCTGG - Intronic
919399927 1:197100237-197100259 CAGCCAAGACAGCACAGAACGGG - Intronic
919463425 1:197904691-197904713 CAGCAAAGCTAGAGCAGGACAGG - Intronic
919794437 1:201312744-201312766 AAGCCAAGACAGCCCAGGAAAGG - Intronic
920028921 1:203024177-203024199 CAGCAGAAGCAGCACAGTACAGG - Exonic
920959487 1:210651869-210651891 CAGTAAGGGCAACCCAGGAAAGG + Intronic
923087208 1:230710757-230710779 CAGCCAGGCCAGCCCAGGCCAGG + Exonic
923113301 1:230910339-230910361 CAGCCAAGGCAAACCAGGGCAGG + Intronic
923146540 1:231202521-231202543 CAGCAAATGCTGGCCAGAACCGG + Intronic
924038791 1:239963280-239963302 CAGCAAGAGCAGCCCTGGGCTGG - Intergenic
924794882 1:247285955-247285977 AAGAAAAGGCAGCACAGGAAAGG - Intergenic
1063010067 10:2012735-2012757 CAGCAAAGGCAGCCCAGGACAGG - Intergenic
1065527490 10:26637949-26637971 CACCAAAGCCAGCCCAAGGCAGG + Intergenic
1065599544 10:27354816-27354838 CAGCCAAGAGAACCCAGGACCGG - Intergenic
1065903360 10:30227410-30227432 CAAAAAAGGCAGCACAGGACAGG + Intergenic
1066455915 10:35572108-35572130 CAGGAAAGCCAGCCCAGAAGAGG - Intronic
1068956093 10:62819243-62819265 CAATAAAGGCCTCCCAGGACTGG - Intronic
1069860192 10:71465995-71466017 CAGCAAGAGCCGCCCAGCACAGG - Intronic
1069913838 10:71775281-71775303 GAGCAAAGCCAGTCCAGGAAGGG - Intronic
1070581033 10:77719709-77719731 CAGCAATGGCAGCATAGGGCTGG - Intergenic
1070954820 10:80456638-80456660 CAGCAAAGGTTTCCCAGGCCTGG - Intronic
1070959520 10:80488811-80488833 GAGCAATGACAGCCCAGGATTGG - Intronic
1073347569 10:102795622-102795644 CACCAGAGGCAGCCCAGGCTCGG - Intronic
1073538751 10:104300983-104301005 CAGAAGAGGCAGCGCATGACAGG + Intronic
1075198732 10:120383438-120383460 CACCAAAGGCTCCCCAGGCCTGG - Intergenic
1075616533 10:123893864-123893886 CTGCAGAGGCAGCCCAGGCCAGG + Intronic
1075733260 10:124648775-124648797 CAGCAAAAGGAGCCCCGAACAGG - Intronic
1076765942 10:132633131-132633153 CACAAAAGGCAGCCAGGGACAGG - Intronic
1076946643 10:133656280-133656302 CAGCACAGGCAGCGGGGGACAGG + Intergenic
1077249560 11:1555056-1555078 CCGGAGAGGCAGCCCAGGGCAGG - Exonic
1077363778 11:2153156-2153178 CATCCAAGGAAGCCCAGGGCAGG - Intronic
1082786038 11:57317362-57317384 CAGAAAAGGCAGCCCAGCCAGGG + Intronic
1083687643 11:64386308-64386330 CAGCAAAGAGAGCCCGGGGCTGG - Intergenic
1083962841 11:66023876-66023898 CAGGAAAGGCAGCCCAGAGGAGG - Intronic
1084144526 11:67257298-67257320 CAGAAAAGGGAGCCCAGAAAAGG + Exonic
1084510582 11:69601134-69601156 GAACAAAGGCAGGCGAGGACTGG - Intergenic
1084520776 11:69661315-69661337 CAGCAAACGAAGCCCAGGCAGGG + Intronic
1085380167 11:76109284-76109306 CAGCAAAGGCAGCTATGGACAGG - Intronic
1085477496 11:76797366-76797388 CAGCAAGGGGAGCCCAGGCGGGG - Exonic
1086444263 11:86857798-86857820 AACCAATGTCAGCCCAGGACAGG + Intronic
1088130076 11:106477423-106477445 CAGCAAAGGAAGCACAGCAAAGG - Intergenic
1088579474 11:111300726-111300748 CAGCAGAGGAAGGCCAGGTCTGG - Intronic
1091173047 11:133535220-133535242 CAGCACTGGCAGCCTAGGAGGGG + Intergenic
1091314863 11:134607279-134607301 CAGAAACAGCAGCCCAAGACAGG - Intergenic
1093215933 12:16361282-16361304 TAGCAATGGCAGTCCAGGTCAGG + Intronic
1095203675 12:39414979-39415001 AAGCAAAATCAGCCTAGGACTGG + Intronic
1095236698 12:39805128-39805150 CAGCAAGGGCAGGCCAGGCCAGG + Intronic
1095850862 12:46803616-46803638 CAGGAAAGCCTGCACAGGACTGG - Intronic
1095950676 12:47780233-47780255 CAGCAAAGTCAGCCCGGTAGCGG - Exonic
1096075364 12:48800534-48800556 CAGGCAGGGCAGCCCAGGGCAGG + Intergenic
1096756772 12:53806139-53806161 CATCAAAGTTAGCCCAGAACGGG - Intergenic
1097720190 12:63011667-63011689 CACCAAAGGAAGACCAAGACTGG - Intergenic
1098050968 12:66452255-66452277 CAGCACAGGCAGCCAGGGAAAGG + Intronic
1098476354 12:70908712-70908734 CAGGCAAGGGAGACCAGGACAGG - Intronic
1098891077 12:76011369-76011391 AGGGAAAGGCAGCCAAGGACAGG + Intergenic
1102516126 12:113448044-113448066 AGGCAAAGGATGCCCAGGACAGG - Intergenic
1102634903 12:114314524-114314546 GAGTAAAGGCATCCCAGGAACGG + Intergenic
1103925403 12:124421082-124421104 CAGCAATGGCAGCCCGGCTCCGG + Intronic
1103955156 12:124572228-124572250 CAGAACAGCCAGCCCAGAACTGG + Intergenic
1105052393 12:133066334-133066356 CAGCAAAGGCTGACCATGAAGGG + Intergenic
1106247798 13:27963685-27963707 CAGCAAAGGGAGGCCAGTGCTGG + Intronic
1106360359 13:29025666-29025688 AGGGAAAGGCAGCCCAGGAAGGG + Exonic
1108897061 13:55344003-55344025 CAGCAAAGGGAGTTAAGGACAGG - Intergenic
1110567340 13:76969606-76969628 AAGCAGAGGCTGCCCAGAACAGG - Intergenic
1112308306 13:98295312-98295334 CAGCAGAGGGAGCCCTGGGCAGG + Intronic
1112555225 13:100461708-100461730 CTGCAAAGGCAGGCAGGGACAGG - Intronic
1113175128 13:107554962-107554984 CAGCAGAGGCCTCCCCGGACAGG - Intronic
1114272198 14:21107705-21107727 CAGCAGCAGCAGCCCAGGTCAGG - Intergenic
1115271374 14:31557176-31557198 CTGGAAATGCAGACCAGGACTGG + Intronic
1117551551 14:56841919-56841941 CAGGAAAGACACTCCAGGACTGG + Intergenic
1118014345 14:61643158-61643180 GAGCCAAGGAAGCCAAGGACTGG - Intronic
1118761010 14:68880132-68880154 CAGCAAAGGGGTCCCAGGCCTGG + Intronic
1119444695 14:74653435-74653457 CAGCAAAAGCAGCCTGGAACTGG - Intronic
1120902682 14:89589624-89589646 CTGTGAAGGCAGCCCAGGACTGG + Intronic
1121060024 14:90898476-90898498 CAACAAAGAGAGCCCAGAACTGG + Intronic
1121544307 14:94752167-94752189 CAGCACAGGCAGTCCAGGTAAGG - Intergenic
1122130034 14:99599592-99599614 TACCAAAGGCAGCCAAGGCCAGG + Intronic
1122541471 14:102499952-102499974 CAGCAGAGGCAGCCCCAGGCCGG + Exonic
1122855734 14:104559323-104559345 CACCAAGGGCAGCCCTGGGCAGG - Intronic
1202920732 14_KI270723v1_random:28834-28856 CAGCACAGGCAGCGGGGGACAGG + Intergenic
1202924186 14_KI270724v1_random:8747-8769 CAGCACAGGCAGCGGGGGACAGG - Intergenic
1123462441 15:20485565-20485587 CAGAAAAGGCTTCCCAGAACAGG + Intergenic
1123655619 15:22514839-22514861 CAGAAAAGGCTTCCCAGAACAGG - Intergenic
1123991585 15:25687538-25687560 GTGCAGAGCCAGCCCAGGACAGG + Intronic
1124066258 15:26346964-26346986 CAGCAAAGGGACCCTAGGCCAGG - Intergenic
1124259840 15:28178842-28178864 GAGCAAAGGCCGCCCCGCACAGG + Intronic
1124273130 15:28301535-28301557 CAGAAAAGGCTTCCCAGAACAGG + Intronic
1124309527 15:28610034-28610056 CAGAAAAGGCTTCCCAGAACAGG - Intergenic
1126189463 15:45864693-45864715 CAGAAAATGCAGCTCAGGACTGG - Intergenic
1126669172 15:51100888-51100910 AAGGACAGGCAGGCCAGGACTGG - Intronic
1126999068 15:54481320-54481342 CAGCAGTGGCAGTGCAGGACTGG + Intronic
1127300445 15:57647815-57647837 CAGCAAAGGCAGACAAGAGCAGG - Intronic
1127931186 15:63598578-63598600 CCTCAAAGGCAGCACGGGACTGG - Intronic
1128004338 15:64224934-64224956 CAGAAAAGAAAGCCCAAGACAGG + Intronic
1129453346 15:75662970-75662992 CAGCACAGGTAGCCCAGGCCTGG - Intergenic
1129727780 15:77910339-77910361 CAGCCAAGGGACACCAGGACTGG - Intergenic
1131189399 15:90301593-90301615 CAGCCAAGGGAGAGCAGGACTGG + Intronic
1131397312 15:92097005-92097027 CACCCAAGGCAGCACAAGACAGG + Intronic
1132090910 15:98947427-98947449 CAGCACCTGCAGCCCAGGACAGG + Intronic
1132374670 15:101321118-101321140 CAGGTCAGGCAGCCCAGGAGTGG - Intronic
1132633495 16:931193-931215 CAGCCAACGCAACCAAGGACTGG + Intronic
1133076837 16:3286324-3286346 TGGCACAGGCAGCCCGGGACTGG + Intronic
1133303137 16:4795311-4795333 CAGCAGAGGCCGCCCAGCCCAGG - Intronic
1133688989 16:8194948-8194970 CAGCAATGGCAGCCCTGAGCTGG + Intergenic
1134450231 16:14358849-14358871 AAGACCAGGCAGCCCAGGACGGG + Intergenic
1134451869 16:14368641-14368663 CAGGGAAGGCGTCCCAGGACGGG - Intergenic
1134877260 16:17712086-17712108 CAGAACATACAGCCCAGGACTGG - Intergenic
1135587195 16:23679988-23680010 AGGCAAAGGAAGCACAGGACTGG - Intronic
1136187947 16:28599177-28599199 GGTCACAGGCAGCCCAGGACAGG + Intergenic
1136190419 16:28612171-28612193 GGTCACAGGCAGCCCAGGACAGG + Intronic
1138121109 16:54401761-54401783 GAGCAGAGGCATCCCAGCACTGG - Intergenic
1138185347 16:54972545-54972567 CAGCAAAAGCAGCACAGGCAGGG - Intergenic
1138883867 16:61050779-61050801 CAGCAGAGGCAGCACAGCTCCGG + Intergenic
1138916486 16:61471208-61471230 CAGCTAAGGCAGCTAAGGAAGGG + Intergenic
1141174642 16:81710848-81710870 CAGCAAAGGCTGACAGGGACAGG - Exonic
1141901759 16:86995682-86995704 CAGCTTAGGCAACCCAGCACGGG + Intergenic
1141908413 16:87042465-87042487 AAGCAAAGGGAACCCAGGAGGGG + Intergenic
1142129871 16:88427660-88427682 CAGCCAAGGCAGGCCAGGGACGG + Exonic
1142297314 16:89233986-89234008 CAGGAAAGGCAGGACAGGGCAGG - Exonic
1142349780 16:89574822-89574844 CAGCACAGGCAGCCTCGGCCTGG - Intergenic
1143175196 17:4951166-4951188 CAGCGAAGACATCCCAGGTCGGG + Exonic
1143319607 17:6059605-6059627 CAGCTAGCGCAGCCCTGGACAGG - Intronic
1144421419 17:15102483-15102505 CAGCAAAGGCTTCCCAAGATGGG - Intergenic
1144815697 17:18033033-18033055 CAGCAAAGGGAGCCAAGTAAAGG + Intronic
1145245064 17:21263338-21263360 CAGTAAAGGCAGGCCAGGCATGG - Intergenic
1145251369 17:21298585-21298607 CAGCAGGGGCTGCCCAGGACAGG - Intronic
1145986204 17:29048617-29048639 AAGCAGGGGCAGCCCAGGTCAGG - Intronic
1146802587 17:35838524-35838546 CAGCTAAGGCAGCCATTGACTGG + Exonic
1147317009 17:39625878-39625900 CTGCAAAGGCACCCAAGGCCCGG + Intergenic
1147546282 17:41404432-41404454 CAGCATAGGAAGCCCAAGAAGGG - Intergenic
1147867099 17:43560266-43560288 CACTAAAGGCAACCCAGGATAGG + Intronic
1148644278 17:49210438-49210460 CAGCAGAGGAAGCCAAGGTCGGG - Exonic
1149001230 17:51759712-51759734 CATCAAAGGAAGCTCAGGAGAGG - Intronic
1151549787 17:74815586-74815608 ATGCAAAAGGAGCCCAGGACTGG - Intronic
1152326683 17:79645608-79645630 CAGCCCAGGGAGCCCAGGCCTGG + Intergenic
1152635768 17:81429939-81429961 CAGCAGAGGCAGCCCGGAGCTGG + Intronic
1152879283 17:82806251-82806273 CAGAACAGGCAGCCCAGGTCAGG - Intronic
1152938108 17:83152345-83152367 GAGCAAGGGGAGCCCGGGACGGG + Intergenic
1153250018 18:3112115-3112137 CATCACAGGCACCTCAGGACAGG - Intronic
1153259177 18:3206399-3206421 GAGCAAAGACAGCCCAGAAGAGG - Intronic
1153457414 18:5295862-5295884 TAGCAAACGCAGGCCGGGACCGG + Exonic
1154496091 18:14962680-14962702 CCGCAGAGGCAGCCGAGGGCTGG - Intergenic
1155147287 18:23094622-23094644 CAGCAAAGGCACCCCAGGGAGGG + Intergenic
1156701563 18:39832048-39832070 CAGCAAATGAATCCTAGGACTGG - Intergenic
1158418778 18:57274028-57274050 CAACAAAAGGAGCCCAGGACTGG - Intergenic
1158593433 18:58796252-58796274 CAACAAAGGCAGGCAAAGACAGG + Intergenic
1158639835 18:59194411-59194433 CAGCAAAGGCATTAGAGGACTGG + Intergenic
1160382172 18:78468157-78468179 CAGGAAGGTCACCCCAGGACTGG - Intergenic
1160580290 18:79879873-79879895 CACCAAAGGCAGGACAGGAAGGG + Intronic
1162426923 19:10602575-10602597 CAGCAGAGGCGGCCCCTGACCGG - Intronic
1162524602 19:11200244-11200266 ATGCAGAGGCAGACCAGGACAGG - Intronic
1162895499 19:13762842-13762864 CAGAGGAGGCTGCCCAGGACCGG + Exonic
1163147049 19:15387158-15387180 CAGGAAAGGCAAACCAAGACCGG + Intronic
1163665768 19:18603601-18603623 CAGAGATGGCAGCCAAGGACAGG + Intronic
1163688654 19:18726328-18726350 CAGCAGAGGAGGCCCAGGCCCGG + Intronic
1164389577 19:27806080-27806102 CAGCCAAGGCAGCCTGGGCCTGG - Intergenic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
1165308390 19:35016021-35016043 GAGGAAGGGTAGCCCAGGACAGG + Intronic
1165339926 19:35204130-35204152 CAGCATGGGCAGGGCAGGACAGG + Intergenic
1168722397 19:58561305-58561327 CAGCTAAGAGACCCCAGGACTGG + Intergenic
925095697 2:1198900-1198922 CAACAAAGAAAGCCCAGGACTGG + Intronic
926112685 2:10193010-10193032 CAGAGAAGGGAGCCCAGGGCAGG - Intronic
927435059 2:23059596-23059618 CAGCTAAGGGGACCCAGGACAGG + Intergenic
927805113 2:26140228-26140250 CAGCAAAAGCAACCCAGCTCTGG + Intergenic
928394308 2:30932012-30932034 CAGCACAGGCAGCCAAGGCTGGG - Intronic
928763458 2:34611948-34611970 CAGCAAAAAAAGCCCAGGACCGG + Intergenic
929663693 2:43816312-43816334 CAGCAAAGGAAGACCGTGACAGG + Intronic
935218136 2:100990571-100990593 CAGCTAAGGAAGCAGAGGACAGG + Intronic
935376007 2:102398237-102398259 CCCCAAAGGGAGCCCAGCACTGG + Exonic
937244202 2:120482107-120482129 GGGCAAAGGCAACGCAGGACTGG - Intergenic
938288793 2:130138677-130138699 CAGAAAGGACAGCCCAGGCCCGG - Intergenic
938467741 2:131534255-131534277 CAGAAAGGACAGCCCAGGCCCGG + Intergenic
940078861 2:149777050-149777072 CAGCAAAGGCAGCACCAAACAGG + Intergenic
942711187 2:178838084-178838106 CAGCAAAGTCAGCTTAGGTCTGG + Intronic
942899897 2:181102919-181102941 CACCAAAGGAAGCCCAGCATGGG - Intergenic
944911401 2:204313891-204313913 CAGCAAAAGCAGTCCAAGAGAGG + Intergenic
946105383 2:217364932-217364954 AAGCAAAGACATCCCAAGACAGG - Intronic
946622343 2:221573221-221573243 CAGACAAGGCAGACCGGGACTGG + Intronic
947869996 2:233429749-233429771 CGGCAAAGGCAGGCCCGGAGGGG - Intronic
948955767 2:241289685-241289707 CTCCAAAGGCATCCAAGGACAGG + Intronic
1168887858 20:1272717-1272739 CTGGAAAGGCAGCCTAGGCCAGG + Intronic
1172088387 20:32407752-32407774 ATGCAAAGGCAGGCCAGGCCAGG - Intronic
1172104450 20:32508254-32508276 CAGCAAAGGCAGGCCAGGGTGGG - Intronic
1173013101 20:39200264-39200286 CAGAAACTCCAGCCCAGGACTGG - Intergenic
1173981013 20:47224272-47224294 AAGCCACTGCAGCCCAGGACGGG + Intronic
1174441796 20:50561476-50561498 CAGCAAAGGAAGAGCAAGACTGG - Intronic
1175132643 20:56801091-56801113 CAGAAAAGGCAGCCTTGGCCAGG - Intergenic
1175544625 20:59770427-59770449 CAGCAAGGGAAGCCCAGGTAAGG - Intronic
1175928118 20:62480752-62480774 GAGCCAAGGAACCCCAGGACTGG - Intergenic
1175949912 20:62577871-62577893 TAGCAGTGGCAGCCCAGGAAAGG + Intergenic
1176107087 20:63394556-63394578 CAGCAAACACAGCCCAGTCCAGG + Intergenic
1176214910 20:63943408-63943430 CAGCAAAGTCTGGCCAGGACAGG + Intronic
1176256653 20:64156540-64156562 CAGCAGGGGCAGCCTAGGCCAGG - Intronic
1176287323 21:5025005-5025027 CAGGAAGAGCAGTCCAGGACTGG - Exonic
1176371852 21:6067101-6067123 CAACAGAAGCAGCCCTGGACTGG - Intergenic
1177181904 21:17753458-17753480 CAACTAAGGCAGCGTAGGACAGG - Intergenic
1178230300 21:30776064-30776086 TAGCAAAAGCTACCCAGGACTGG - Intergenic
1179028259 21:37698323-37698345 CAGCAAGGGCAGCCCCCGCCTGG - Intronic
1179321118 21:40291855-40291877 GAGCAAAGGAGGCCCAGGCCAGG + Intronic
1179440258 21:41388469-41388491 CAGGCAAGGCAGCCCAGGTAGGG - Intronic
1179629063 21:42665614-42665636 CAGCAAGGGCCGGCCAGGGCAGG - Intronic
1179751667 21:43471438-43471460 CAACAGAAGCAGCCCTGGACTGG + Intergenic
1179869858 21:44238470-44238492 CAGGAAGAGCAGTCCAGGACTGG + Exonic
1179885368 21:44312021-44312043 CACCAGAGGGACCCCAGGACTGG - Intronic
1179962153 21:44773704-44773726 CAGCCAAGTGAGCCCAGGAATGG + Intronic
1180757701 22:18174158-18174180 CAGCAAAGGCTTCACAGGATAGG - Intronic
1180956524 22:19743741-19743763 AAGCAAAGGCAGGCGAGGGCAGG + Intergenic
1181074072 22:20363287-20363309 CAGCAAAGGCTTCACAGGATAGG + Intronic
1181165561 22:20981174-20981196 CAGCAGAGGCCTCCCAGGAGGGG - Exonic
1181476029 22:23168352-23168374 CAACCAAGGGAGCCCAGGACAGG + Intergenic
1183357485 22:37367427-37367449 CAGGACAGGCTGCCCAGGCCAGG + Intergenic
1183434407 22:37785082-37785104 CAGGGAAGGCTGCACAGGACAGG + Intergenic
1183594046 22:38799083-38799105 CAGCAAGAGCAGCCCAAGAAAGG - Intergenic
1183606109 22:38867495-38867517 CAGCAAGGGCAGCCATGGAGTGG - Intronic
1183742086 22:39674403-39674425 CAGGGAAGGCAGCCTAGGAAAGG + Intronic
1184029525 22:41883756-41883778 GAGGCAAGGCAGCCCAGGAGGGG + Intronic
1184090697 22:42291601-42291623 CAGCAAAGGCAGCCCCTGCATGG + Intronic
1185277572 22:49956450-49956472 CACCAAAGGCATCCCAGGGTTGG - Intergenic
1185295854 22:50054411-50054433 CAGGAGAGGGAGCCCAGGAGAGG - Intronic
950177390 3:10884640-10884662 CCGGAATGCCAGCCCAGGACTGG - Intronic
950313701 3:11981534-11981556 CAGAAAAGGCATCCCAGTCCAGG + Intergenic
950703034 3:14763099-14763121 CACCAAGGGCAGGACAGGACAGG + Intronic
951674128 3:25217800-25217822 TTGCAAAGGGAGCTCAGGACAGG - Intronic
951857084 3:27209682-27209704 CAGCAAAGGTGGGCCACGACTGG + Intronic
954696582 3:52430538-52430560 CAGCAAAGGTGGCCAGGGACTGG + Intergenic
954802371 3:53194626-53194648 CACCTCAAGCAGCCCAGGACAGG + Intergenic
955913121 3:63878830-63878852 CAGAAAAGGGAGCCCAGAGCAGG + Intronic
955924097 3:63989034-63989056 AAGCAATAGCAGCCGAGGACTGG - Intronic
957080812 3:75634129-75634151 CAGCATAGGCAGCGGGGGACAGG - Intergenic
957217065 3:77334349-77334371 AAGCACAGGCAATCCAGGACAGG - Intronic
962361935 3:134750070-134750092 CAGGGAAAGCAGCCCAGGAAAGG - Intronic
962402724 3:135075174-135075196 CTGAAAAGGAAGCCCAGGGCTGG - Intronic
962655661 3:137542088-137542110 CAGCAACGGCAACACAGAACAGG + Intergenic
963204065 3:142614767-142614789 CAGCAGATGGAGCCCAGGCCAGG - Intronic
964296479 3:155239719-155239741 CAGCAATGGCAGCTCAGGACAGG + Intergenic
964647079 3:158969727-158969749 CAGCTGAGGCAGCCCTGGATTGG + Intronic
965743991 3:171905853-171905875 CAAAAAAGCCAGCCCAGGCCGGG - Intronic
965860734 3:173146761-173146783 CAGCAAAGCCATAGCAGGACAGG + Intergenic
967264102 3:187674967-187674989 CAGCAAAAACAGCCATGGACTGG + Intergenic
967735801 3:192951100-192951122 GAGCCAAAGCAGCCCAGGGCCGG + Intergenic
968511536 4:997813-997835 CAGCGAGGGGAGCCCGGGACAGG - Intronic
968571577 4:1344994-1345016 CAGCAAACACAGGCCACGACAGG + Intergenic
969505132 4:7581610-7581632 CAGCAAACTCCACCCAGGACAGG + Intronic
969641428 4:8401430-8401452 CAGAGCTGGCAGCCCAGGACCGG - Intronic
969900380 4:10343943-10343965 CAACAAAGGCAGCCCAGCCTTGG - Intergenic
970266218 4:14289694-14289716 AACCAAAAGAAGCCCAGGACTGG + Intergenic
971199699 4:24500683-24500705 CAGCTGATGCATCCCAGGACCGG + Intergenic
971708250 4:30076653-30076675 CATCAAAAAAAGCCCAGGACGGG - Intergenic
976902057 4:90190680-90190702 CAACAAATGCAGGCCAGAACTGG - Intronic
977459378 4:97306133-97306155 CAGCATAGAAACCCCAGGACTGG + Intronic
978045014 4:104114825-104114847 CAGCAGAGGCAGCCTAAGCCTGG + Intergenic
978539750 4:109804095-109804117 CAGCAAAGCAGGCCCAGGAGTGG - Intergenic
981557711 4:146013435-146013457 CAGCAAAAGCAGCATAGAACAGG - Intergenic
981808169 4:148740959-148740981 CAGCACAGGCAGTGCAGGGCTGG + Intergenic
982264729 4:153527734-153527756 GAGGAAACGCAGCCCAGGAAGGG + Intronic
982890478 4:160843111-160843133 CAGCAAAGCCAGCTCCGTACTGG + Intergenic
984811562 4:183799873-183799895 CAGCAGAGACAGCTCAGGCCAGG - Intergenic
985450097 4:190057079-190057101 CAGCACAGGCAGCGGGGGACAGG + Intergenic
985710987 5:1429827-1429849 GAGCACATGCAGCCCAGGCCTGG + Intronic
986343292 5:6811174-6811196 CAGCAAAGGCAGGGCCAGACCGG + Intergenic
987429012 5:17808771-17808793 CAGCAAATGCAGGCTAGAACAGG - Intergenic
987470689 5:18323848-18323870 CAGGAAAGACAGCCCTGGACAGG + Intergenic
988394409 5:30679136-30679158 CAGCAGAGGCACCCTAGGATTGG - Intergenic
988461245 5:31439879-31439901 GAGCAAAGACAGCAAAGGACAGG + Intronic
989028023 5:37088711-37088733 CACCACAGGGAGCACAGGACTGG + Intergenic
990447148 5:55903758-55903780 CTGCAGAAGCAGGCCAGGACAGG + Intronic
990490593 5:56299372-56299394 GGGCAAAGGCAGCCCAGGCCGGG + Intergenic
991016996 5:61943074-61943096 CAGCAAAGGCAGCCTTAAACAGG + Intergenic
992084640 5:73267136-73267158 CAGGAAAGAAAGCCCAGTACTGG - Intergenic
993455623 5:88123744-88123766 CAACAAAAACAGCCTAGGACTGG + Intergenic
997632359 5:135378389-135378411 AAGGATAGGCAGCCCTGGACAGG - Intronic
998132751 5:139659590-139659612 CCGCAGCGGCAGCTCAGGACAGG - Intronic
998629288 5:143880587-143880609 CAGGAAATGCAGCCTATGACGGG + Intergenic
1001013388 5:168118560-168118582 CAAAACACGCAGCCCAGGACTGG - Intronic
1001476420 5:172054191-172054213 CAGCAAAAGCAGCCCACAAGGGG + Intronic
1002961093 6:1915436-1915458 CAGCAGGGGCAGCCCAGGGCCGG + Intronic
1003235807 6:4294526-4294548 CAGAACATGCAGCCCAGGTCTGG - Intergenic
1003364360 6:5458220-5458242 CAGCAAAGCCTGCCCATGACTGG + Intronic
1003823327 6:9924855-9924877 GAGCAAAGGCAGAGCAGGCCAGG + Intronic
1004107133 6:12676397-12676419 CAGCAATGTGAGGCCAGGACAGG - Intergenic
1004947282 6:20629806-20629828 CAAGACAGGCAGCCCAGCACAGG - Intronic
1006970785 6:38042925-38042947 CTGCCAAGGATGCCCAGGACAGG + Intronic
1008535321 6:52502923-52502945 CAGAAAAGCCAGCACAGGACAGG + Exonic
1008805077 6:55417129-55417151 CAGCAAAGCCAGCTGAGGAGGGG + Intergenic
1010681982 6:78808515-78808537 CTGCAGAGGCAGCACAGTACAGG + Intergenic
1011578537 6:88830956-88830978 AACCAAAAACAGCCCAGGACCGG + Intronic
1011721091 6:90157493-90157515 AAGTAAAGCCAACCCAGGACTGG + Intronic
1012493303 6:99807314-99807336 CTGCAAAAGCAGCACAGGAAAGG - Intergenic
1012588033 6:100946973-100946995 CACCACTGGCAGCACAGGACTGG + Intergenic
1017054528 6:150425169-150425191 CAGCAGAGGCAGCACTGGATGGG - Intergenic
1017225691 6:152018644-152018666 CAGCAAAGTCAGTCCTGGGCAGG + Intronic
1017693643 6:156992544-156992566 CAGAAAAGGCACCCCGGGAATGG + Intronic
1018723186 6:166589285-166589307 GAGCAAAGGAACCCCAGGAGGGG - Intronic
1018766344 6:166936277-166936299 CAGCAATGGCAGGGCAGCACTGG + Intronic
1019093337 6:169558512-169558534 GAGCACAGGCAGCCGAGGATTGG + Intronic
1019207516 6:170375090-170375112 CAGCAGAGGGAGCCCTGAACTGG - Intronic
1019336558 7:485604-485626 CAGCAAAATCAACACAGGACAGG + Intergenic
1019489528 7:1305682-1305704 CAGCCAAGGCAGACGAAGACAGG + Intergenic
1019779539 7:2931204-2931226 CAGCAGAGGGAGGCCAGGGCGGG - Intronic
1022386130 7:29900957-29900979 CAGGAATTGCAGCCCAGGGCTGG + Intronic
1022455705 7:30556572-30556594 CAGCAGAGGCAGCAGAGGCCCGG + Intergenic
1024023529 7:45391814-45391836 CAGGAATGGCAGGCCTGGACGGG - Intergenic
1024143030 7:46481066-46481088 GAGAGAAGGCAGCCCAGGAAGGG - Intergenic
1025015969 7:55439407-55439429 CAGCACAGGCAGCACTTGACAGG + Intronic
1025627494 7:63234286-63234308 CAGAAGAGGAAGTCCAGGACAGG + Intergenic
1026458175 7:70591079-70591101 ACACAAAGGCAGGCCAGGACTGG - Intronic
1026684229 7:72494579-72494601 CATCAAAGGCAACACAGGCCGGG + Intergenic
1026877406 7:73887431-73887453 CAGTACAGACAGCCCAGGAAAGG - Intergenic
1028670772 7:93397948-93397970 CAGCAAAGGCAGGCTATGCCAGG + Intergenic
1029607272 7:101606525-101606547 CTGCCAAGCAAGCCCAGGACTGG + Intergenic
1031932581 7:127701198-127701220 AAGCAAAGGCAGCCAAGAAAGGG + Exonic
1032016377 7:128382797-128382819 CAGAGAAGGGAGCCCAGGAAAGG + Intergenic
1032284306 7:130529200-130529222 CAGCAAGGGCAGGGCAGGAAGGG + Intronic
1032420377 7:131774566-131774588 AAACAAGGGCAGCCCAGGAAAGG - Intergenic
1032761125 7:134943268-134943290 CACCTAAGGAAGCCAAGGACGGG + Intronic
1033766000 7:144491264-144491286 AAGCAAAGGCAGCACCTGACAGG - Intronic
1035398205 7:158548809-158548831 CACCAAAGCCAGCGCAGGAGGGG + Intronic
1037362938 8:18092845-18092867 AAGCAAAAGCAGACCAGGCCAGG - Intergenic
1040533095 8:48282066-48282088 CAGGCAAGGCCACCCAGGACCGG - Intergenic
1040593646 8:48818400-48818422 CAGCCAGGGCAGCTCAGGAGTGG + Intergenic
1041409295 8:57535914-57535936 TAGGAAAGCCAGCCCAGGTCAGG + Intergenic
1042681020 8:71384411-71384433 CAGAGAAGGCAACCCAGGTCAGG - Intergenic
1044467791 8:92526639-92526661 CAGCAGTGGCAGCAGAGGACTGG - Intergenic
1045060595 8:98407385-98407407 GAGCAAAGGGAGCACTGGACAGG + Intronic
1045990226 8:108297941-108297963 TAGTAAAGGCAGCCCTGGCCGGG - Intronic
1049612385 8:143561612-143561634 CAACACTGGCAGCCCAGGGCAGG - Intronic
1050462234 9:5886680-5886702 CACCAAAGCCAGCCCAAGTCAGG - Intronic
1050611071 9:7354368-7354390 CAGCAAAGAAAGCCTAGGATAGG + Intergenic
1051564860 9:18486001-18486023 CAGCAAAGGGAGCCCACAAGAGG - Intronic
1055758803 9:79584131-79584153 CAGCGAAGGGAGCCCTGGAAGGG - Intronic
1056936730 9:90920197-90920219 CAGCCAAGGCTGTCCAGGAGGGG - Intergenic
1057047528 9:91897790-91897812 TTCCAAAGGCAGCCCAGGCCCGG + Intronic
1057279301 9:93698613-93698635 CAGGGAAGGCAGCCCTGGGCAGG - Intergenic
1057840350 9:98481173-98481195 CAGGAAAGCCAGCCCTGGAGAGG - Intronic
1058815605 9:108680291-108680313 CACCCAAGGCAGCCCAAGGCAGG + Intergenic
1058836493 9:108862489-108862511 AATCAAAGGCAGCCAAGGAGAGG + Exonic
1059695924 9:116730503-116730525 CTGCAAAGGAAGGCCAGGAGAGG - Intronic
1061252742 9:129436277-129436299 CAGCAGAGGGAGCCCAGCATGGG + Intergenic
1061485305 9:130917596-130917618 CTGCAGAGGCAGCCCTGGGCGGG - Intronic
1061959771 9:133982095-133982117 CAGGAAAGGCTTCCCAGGACAGG + Intronic
1061973679 9:134057815-134057837 ACACAAAGGCAGCCCAGGGCAGG + Intronic
1062424538 9:136500024-136500046 CTGCAAAGGCAGCCCCTGCCAGG + Intronic
1062433930 9:136538163-136538185 GAGCAAAGGGAGCTAAGGACTGG - Intronic
1062717175 9:138016831-138016853 CAGCACACACTGCCCAGGACAGG - Intronic
1186515556 X:10164103-10164125 CAGCAAAGGATGCACAGCACTGG + Intronic
1188085234 X:25895213-25895235 CACCTCAGGGAGCCCAGGACTGG + Intergenic
1189274938 X:39778731-39778753 CAGAGAAGGCAGGCCAGGGCTGG + Intergenic
1194344803 X:92750666-92750688 CATCAGTGGCAGCACAGGACAGG + Intergenic
1195715278 X:107812353-107812375 CACCTAACCCAGCCCAGGACAGG + Intergenic
1196933038 X:120700246-120700268 CAACAAAAAAAGCCCAGGACTGG + Intergenic
1198141204 X:133805387-133805409 GAGCAGGGGCAGCCTAGGACTGG + Intronic
1199269217 X:145863554-145863576 CAGAAAAAGCAGCCTAGGTCAGG - Intergenic
1199947852 X:152682041-152682063 CAGAAAAGGCAGGGCAGGGCTGG - Intergenic
1199961827 X:152786413-152786435 CAGAAAAGGCAGGGCAGGGCTGG + Intergenic
1200653149 Y:5867307-5867329 CATCAGTGGCAGCACAGGACAGG + Intergenic