ID: 1063014958

View in Genome Browser
Species Human (GRCh38)
Location 10:2066739-2066761
Sequence AAGAGCTTCTTGAACCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063014955_1063014958 0 Left 1063014955 10:2066716-2066738 CCAGCTACTCAGGAGACCGAAGC No data
Right 1063014958 10:2066739-2066761 AAGAGCTTCTTGAACCCTGGAGG No data
1063014952_1063014958 11 Left 1063014952 10:2066705-2066727 CCTATATAGTCCCAGCTACTCAG 0: 10
1: 106
2: 774
3: 2169
4: 2905
Right 1063014958 10:2066739-2066761 AAGAGCTTCTTGAACCCTGGAGG No data
1063014954_1063014958 1 Left 1063014954 10:2066715-2066737 CCCAGCTACTCAGGAGACCGAAG No data
Right 1063014958 10:2066739-2066761 AAGAGCTTCTTGAACCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063014958 Original CRISPR AAGAGCTTCTTGAACCCTGG AGG Intergenic
No off target data available for this crispr