ID: 1063015582

View in Genome Browser
Species Human (GRCh38)
Location 10:2073749-2073771
Sequence ATGTGGGTATGGAGTCAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063015582_1063015589 9 Left 1063015582 10:2073749-2073771 CCACCTTGACTCCATACCCACAT No data
Right 1063015589 10:2073781-2073803 CTAAATGCCAAACAATAAATTGG No data
1063015582_1063015590 10 Left 1063015582 10:2073749-2073771 CCACCTTGACTCCATACCCACAT No data
Right 1063015590 10:2073782-2073804 TAAATGCCAAACAATAAATTGGG No data
1063015582_1063015592 22 Left 1063015582 10:2073749-2073771 CCACCTTGACTCCATACCCACAT No data
Right 1063015592 10:2073794-2073816 AATAAATTGGGAGCTTTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063015582 Original CRISPR ATGTGGGTATGGAGTCAAGG TGG (reversed) Intergenic
No off target data available for this crispr