ID: 1063016835

View in Genome Browser
Species Human (GRCh38)
Location 10:2086830-2086852
Sequence ACTCAGATGCAGACTGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063016835_1063016838 17 Left 1063016835 10:2086830-2086852 CCTCCCACAGTCTGCATCTGAGT No data
Right 1063016838 10:2086870-2086892 TCGTAGTCTTGAACATTTACAGG No data
1063016835_1063016839 18 Left 1063016835 10:2086830-2086852 CCTCCCACAGTCTGCATCTGAGT No data
Right 1063016839 10:2086871-2086893 CGTAGTCTTGAACATTTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063016835 Original CRISPR ACTCAGATGCAGACTGTGGG AGG (reversed) Intergenic
No off target data available for this crispr