ID: 1063018965

View in Genome Browser
Species Human (GRCh38)
Location 10:2106966-2106988
Sequence AAGTAGCTACAAGCCTACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063018962_1063018965 -6 Left 1063018962 10:2106949-2106971 CCAGGCCCTTTGTTGACAAGTAG No data
Right 1063018965 10:2106966-2106988 AAGTAGCTACAAGCCTACATAGG No data
1063018960_1063018965 14 Left 1063018960 10:2106929-2106951 CCTCAAGGAATAAATTAATTCCA No data
Right 1063018965 10:2106966-2106988 AAGTAGCTACAAGCCTACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063018965 Original CRISPR AAGTAGCTACAAGCCTACAT AGG Intergenic
No off target data available for this crispr