ID: 1063019752

View in Genome Browser
Species Human (GRCh38)
Location 10:2115995-2116017
Sequence AGGTTGTTATTTCTGCTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063019752_1063019754 -5 Left 1063019752 10:2115995-2116017 CCATGAAGCAGAAATAACAACCT No data
Right 1063019754 10:2116013-2116035 AACCTCTCTGACAACATGAAGGG No data
1063019752_1063019753 -6 Left 1063019752 10:2115995-2116017 CCATGAAGCAGAAATAACAACCT No data
Right 1063019753 10:2116012-2116034 CAACCTCTCTGACAACATGAAGG No data
1063019752_1063019757 -3 Left 1063019752 10:2115995-2116017 CCATGAAGCAGAAATAACAACCT No data
Right 1063019757 10:2116015-2116037 CCTCTCTGACAACATGAAGGGGG No data
1063019752_1063019755 -4 Left 1063019752 10:2115995-2116017 CCATGAAGCAGAAATAACAACCT No data
Right 1063019755 10:2116014-2116036 ACCTCTCTGACAACATGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063019752 Original CRISPR AGGTTGTTATTTCTGCTTCA TGG (reversed) Intergenic
No off target data available for this crispr