ID: 1063020940

View in Genome Browser
Species Human (GRCh38)
Location 10:2127093-2127115
Sequence CATTATGCAAACAGAGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063020940_1063020946 8 Left 1063020940 10:2127093-2127115 CCACCCTCTCTGTTTGCATAATG No data
Right 1063020946 10:2127124-2127146 TTGGATGTAGCAGCATCTAGGGG No data
1063020940_1063020947 20 Left 1063020940 10:2127093-2127115 CCACCCTCTCTGTTTGCATAATG No data
Right 1063020947 10:2127136-2127158 GCATCTAGGGGTCACTGATTTGG No data
1063020940_1063020948 21 Left 1063020940 10:2127093-2127115 CCACCCTCTCTGTTTGCATAATG No data
Right 1063020948 10:2127137-2127159 CATCTAGGGGTCACTGATTTGGG No data
1063020940_1063020944 6 Left 1063020940 10:2127093-2127115 CCACCCTCTCTGTTTGCATAATG No data
Right 1063020944 10:2127122-2127144 CTTTGGATGTAGCAGCATCTAGG No data
1063020940_1063020945 7 Left 1063020940 10:2127093-2127115 CCACCCTCTCTGTTTGCATAATG No data
Right 1063020945 10:2127123-2127145 TTTGGATGTAGCAGCATCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063020940 Original CRISPR CATTATGCAAACAGAGAGGG TGG (reversed) Intergenic
No off target data available for this crispr