ID: 1063020966

View in Genome Browser
Species Human (GRCh38)
Location 10:2127257-2127279
Sequence TGTACCACGCAGTAACTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063020956_1063020966 15 Left 1063020956 10:2127219-2127241 CCTCTTATACCTTCATCAATTCA No data
Right 1063020966 10:2127257-2127279 TGTACCACGCAGTAACTGGTGGG No data
1063020957_1063020966 6 Left 1063020957 10:2127228-2127250 CCTTCATCAATTCAATACCCAGG No data
Right 1063020966 10:2127257-2127279 TGTACCACGCAGTAACTGGTGGG No data
1063020955_1063020966 28 Left 1063020955 10:2127206-2127228 CCTCTTCACTGTGCCTCTTATAC No data
Right 1063020966 10:2127257-2127279 TGTACCACGCAGTAACTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063020966 Original CRISPR TGTACCACGCAGTAACTGGT GGG Intergenic
No off target data available for this crispr