ID: 1063028069

View in Genome Browser
Species Human (GRCh38)
Location 10:2202549-2202571
Sequence CCTGAATTCCAGAGGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063028063_1063028069 15 Left 1063028063 10:2202511-2202533 CCAGATCTCTGTTTTAACGTGAA No data
Right 1063028069 10:2202549-2202571 CCTGAATTCCAGAGGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063028069 Original CRISPR CCTGAATTCCAGAGGGAGCA GGG Intergenic
No off target data available for this crispr