ID: 1063034539

View in Genome Browser
Species Human (GRCh38)
Location 10:2272455-2272477
Sequence GACCTCACACCGTTTTCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063034539_1063034545 -1 Left 1063034539 10:2272455-2272477 CCAGAAGAAAACGGTGTGAGGTC No data
Right 1063034545 10:2272477-2272499 CTCTATAAAGTTAGGGGGCAGGG No data
1063034539_1063034542 -7 Left 1063034539 10:2272455-2272477 CCAGAAGAAAACGGTGTGAGGTC No data
Right 1063034542 10:2272471-2272493 TGAGGTCTCTATAAAGTTAGGGG No data
1063034539_1063034544 -2 Left 1063034539 10:2272455-2272477 CCAGAAGAAAACGGTGTGAGGTC No data
Right 1063034544 10:2272476-2272498 TCTCTATAAAGTTAGGGGGCAGG No data
1063034539_1063034540 -9 Left 1063034539 10:2272455-2272477 CCAGAAGAAAACGGTGTGAGGTC No data
Right 1063034540 10:2272469-2272491 TGTGAGGTCTCTATAAAGTTAGG No data
1063034539_1063034541 -8 Left 1063034539 10:2272455-2272477 CCAGAAGAAAACGGTGTGAGGTC No data
Right 1063034541 10:2272470-2272492 GTGAGGTCTCTATAAAGTTAGGG No data
1063034539_1063034543 -6 Left 1063034539 10:2272455-2272477 CCAGAAGAAAACGGTGTGAGGTC No data
Right 1063034543 10:2272472-2272494 GAGGTCTCTATAAAGTTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063034539 Original CRISPR GACCTCACACCGTTTTCTTC TGG (reversed) Intergenic