ID: 1063034541

View in Genome Browser
Species Human (GRCh38)
Location 10:2272470-2272492
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063034539_1063034541 -8 Left 1063034539 10:2272455-2272477 CCAGAAGAAAACGGTGTGAGGTC No data
Right 1063034541 10:2272470-2272492 GTGAGGTCTCTATAAAGTTAGGG No data
1063034536_1063034541 -2 Left 1063034536 10:2272449-2272471 CCCAAGCCAGAAGAAAACGGTGT No data
Right 1063034541 10:2272470-2272492 GTGAGGTCTCTATAAAGTTAGGG No data
1063034534_1063034541 1 Left 1063034534 10:2272446-2272468 CCACCCAAGCCAGAAGAAAACGG No data
Right 1063034541 10:2272470-2272492 GTGAGGTCTCTATAAAGTTAGGG No data
1063034537_1063034541 -3 Left 1063034537 10:2272450-2272472 CCAAGCCAGAAGAAAACGGTGTG No data
Right 1063034541 10:2272470-2272492 GTGAGGTCTCTATAAAGTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063034541 Original CRISPR GTGAGGTCTCTATAAAGTTA GGG Intergenic