ID: 1063042029

View in Genome Browser
Species Human (GRCh38)
Location 10:2351725-2351747
Sequence TCATTTGCAATCGTGTTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063042018_1063042029 30 Left 1063042018 10:2351672-2351694 CCAGCACAATCTGTGAACCGAGG No data
Right 1063042029 10:2351725-2351747 TCATTTGCAATCGTGTTCTGAGG No data
1063042028_1063042029 -7 Left 1063042028 10:2351709-2351731 CCGGACGTCACAGGTGTCATTTG No data
Right 1063042029 10:2351725-2351747 TCATTTGCAATCGTGTTCTGAGG No data
1063042025_1063042029 13 Left 1063042025 10:2351689-2351711 CCGAGGCGCGGGGTGGGCTGCCG No data
Right 1063042029 10:2351725-2351747 TCATTTGCAATCGTGTTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063042029 Original CRISPR TCATTTGCAATCGTGTTCTG AGG Intergenic
No off target data available for this crispr