ID: 1063046019

View in Genome Browser
Species Human (GRCh38)
Location 10:2393111-2393133
Sequence CCCACACAGAAGGGGAGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063046019_1063046025 17 Left 1063046019 10:2393111-2393133 CCTTGGCTCCCCTTCTGTGTGGG No data
Right 1063046025 10:2393151-2393173 ATGAGTGTGTGTACCTCAAGAGG No data
1063046019_1063046030 30 Left 1063046019 10:2393111-2393133 CCTTGGCTCCCCTTCTGTGTGGG No data
Right 1063046030 10:2393164-2393186 CCTCAAGAGGGTGGCTGGCATGG No data
1063046019_1063046028 25 Left 1063046019 10:2393111-2393133 CCTTGGCTCCCCTTCTGTGTGGG No data
Right 1063046028 10:2393159-2393181 GTGTACCTCAAGAGGGTGGCTGG No data
1063046019_1063046027 21 Left 1063046019 10:2393111-2393133 CCTTGGCTCCCCTTCTGTGTGGG No data
Right 1063046027 10:2393155-2393177 GTGTGTGTACCTCAAGAGGGTGG No data
1063046019_1063046026 18 Left 1063046019 10:2393111-2393133 CCTTGGCTCCCCTTCTGTGTGGG No data
Right 1063046026 10:2393152-2393174 TGAGTGTGTGTACCTCAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063046019 Original CRISPR CCCACACAGAAGGGGAGCCA AGG (reversed) Intergenic
No off target data available for this crispr