ID: 1063049381

View in Genome Browser
Species Human (GRCh38)
Location 10:2430224-2430246
Sequence CTGTGGGAGGCTGTGTGATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063049381_1063049385 -7 Left 1063049381 10:2430224-2430246 CCCAATCACACAGCCTCCCACAG No data
Right 1063049385 10:2430240-2430262 CCCACAGTGACCTTGAGAGTCGG No data
1063049381_1063049389 6 Left 1063049381 10:2430224-2430246 CCCAATCACACAGCCTCCCACAG No data
Right 1063049389 10:2430253-2430275 TGAGAGTCGGGCATAATGAGAGG No data
1063049381_1063049387 -6 Left 1063049381 10:2430224-2430246 CCCAATCACACAGCCTCCCACAG No data
Right 1063049387 10:2430241-2430263 CCACAGTGACCTTGAGAGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063049381 Original CRISPR CTGTGGGAGGCTGTGTGATT GGG (reversed) Intergenic
No off target data available for this crispr