ID: 1063055559

View in Genome Browser
Species Human (GRCh38)
Location 10:2500641-2500663
Sequence GCGTCTGAACGTGTGTACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063055559_1063055561 6 Left 1063055559 10:2500641-2500663 CCAGTGTACACACGTTCAGACGC No data
Right 1063055561 10:2500670-2500692 GCTTACACACACAAACACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063055559 Original CRISPR GCGTCTGAACGTGTGTACAC TGG (reversed) Intergenic
No off target data available for this crispr