ID: 1063055561

View in Genome Browser
Species Human (GRCh38)
Location 10:2500670-2500692
Sequence GCTTACACACACAAACACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063055557_1063055561 12 Left 1063055557 10:2500635-2500657 CCACCTCCAGTGTACACACGTTC No data
Right 1063055561 10:2500670-2500692 GCTTACACACACAAACACACAGG No data
1063055558_1063055561 9 Left 1063055558 10:2500638-2500660 CCTCCAGTGTACACACGTTCAGA No data
Right 1063055561 10:2500670-2500692 GCTTACACACACAAACACACAGG No data
1063055559_1063055561 6 Left 1063055559 10:2500641-2500663 CCAGTGTACACACGTTCAGACGC No data
Right 1063055561 10:2500670-2500692 GCTTACACACACAAACACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063055561 Original CRISPR GCTTACACACACAAACACAC AGG Intergenic
No off target data available for this crispr