ID: 1063055725

View in Genome Browser
Species Human (GRCh38)
Location 10:2502103-2502125
Sequence CTCAGTTGCCCAAGTGACGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063055725_1063055726 -7 Left 1063055725 10:2502103-2502125 CCTTCGTCACTTGGGCAACTGAG No data
Right 1063055726 10:2502119-2502141 AACTGAGCCTTCTGTTAAGCAGG No data
1063055725_1063055727 -6 Left 1063055725 10:2502103-2502125 CCTTCGTCACTTGGGCAACTGAG No data
Right 1063055727 10:2502120-2502142 ACTGAGCCTTCTGTTAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063055725 Original CRISPR CTCAGTTGCCCAAGTGACGA AGG (reversed) Intergenic
No off target data available for this crispr