ID: 1063056240

View in Genome Browser
Species Human (GRCh38)
Location 10:2507453-2507475
Sequence CCTCCCCTTCAGAGGGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063056240_1063056249 22 Left 1063056240 10:2507453-2507475 CCATCATCCCTCTGAAGGGGAGG No data
Right 1063056249 10:2507498-2507520 GATGCTCCCGGGGACATCTCAGG No data
1063056240_1063056247 11 Left 1063056240 10:2507453-2507475 CCATCATCCCTCTGAAGGGGAGG No data
Right 1063056247 10:2507487-2507509 CTCTTATTTTGGATGCTCCCGGG No data
1063056240_1063056246 10 Left 1063056240 10:2507453-2507475 CCATCATCCCTCTGAAGGGGAGG No data
Right 1063056246 10:2507486-2507508 ACTCTTATTTTGGATGCTCCCGG No data
1063056240_1063056248 12 Left 1063056240 10:2507453-2507475 CCATCATCCCTCTGAAGGGGAGG No data
Right 1063056248 10:2507488-2507510 TCTTATTTTGGATGCTCCCGGGG No data
1063056240_1063056244 0 Left 1063056240 10:2507453-2507475 CCATCATCCCTCTGAAGGGGAGG No data
Right 1063056244 10:2507476-2507498 AAAGCCTCTCACTCTTATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063056240 Original CRISPR CCTCCCCTTCAGAGGGATGA TGG (reversed) Intergenic