ID: 1063056357

View in Genome Browser
Species Human (GRCh38)
Location 10:2509155-2509177
Sequence AGACACAGCCTTTCTTTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063056357_1063056363 23 Left 1063056357 10:2509155-2509177 CCAGGGAAAGAAAGGCTGTGTCT No data
Right 1063056363 10:2509201-2509223 TCTGCTGACTCAGAGGGTCCAGG No data
1063056357_1063056362 17 Left 1063056357 10:2509155-2509177 CCAGGGAAAGAAAGGCTGTGTCT No data
Right 1063056362 10:2509195-2509217 GCTACATCTGCTGACTCAGAGGG No data
1063056357_1063056359 -6 Left 1063056357 10:2509155-2509177 CCAGGGAAAGAAAGGCTGTGTCT No data
Right 1063056359 10:2509172-2509194 GTGTCTCTGCGTCAGAGGTTTGG No data
1063056357_1063056364 24 Left 1063056357 10:2509155-2509177 CCAGGGAAAGAAAGGCTGTGTCT No data
Right 1063056364 10:2509202-2509224 CTGCTGACTCAGAGGGTCCAGGG No data
1063056357_1063056360 -5 Left 1063056357 10:2509155-2509177 CCAGGGAAAGAAAGGCTGTGTCT No data
Right 1063056360 10:2509173-2509195 TGTCTCTGCGTCAGAGGTTTGGG No data
1063056357_1063056365 25 Left 1063056357 10:2509155-2509177 CCAGGGAAAGAAAGGCTGTGTCT No data
Right 1063056365 10:2509203-2509225 TGCTGACTCAGAGGGTCCAGGGG No data
1063056357_1063056361 16 Left 1063056357 10:2509155-2509177 CCAGGGAAAGAAAGGCTGTGTCT No data
Right 1063056361 10:2509194-2509216 GGCTACATCTGCTGACTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063056357 Original CRISPR AGACACAGCCTTTCTTTCCC TGG (reversed) Intergenic
No off target data available for this crispr