ID: 1063056364

View in Genome Browser
Species Human (GRCh38)
Location 10:2509202-2509224
Sequence CTGCTGACTCAGAGGGTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063056357_1063056364 24 Left 1063056357 10:2509155-2509177 CCAGGGAAAGAAAGGCTGTGTCT No data
Right 1063056364 10:2509202-2509224 CTGCTGACTCAGAGGGTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063056364 Original CRISPR CTGCTGACTCAGAGGGTCCA GGG Intergenic
No off target data available for this crispr