ID: 1063072595

View in Genome Browser
Species Human (GRCh38)
Location 10:2680954-2680976
Sequence CGTCCACACAGGCAGCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063072589_1063072595 21 Left 1063072589 10:2680910-2680932 CCGATTCTCTGGTGCTCCCTCAG No data
Right 1063072595 10:2680954-2680976 CGTCCACACAGGCAGCTGCAAGG No data
1063072591_1063072595 4 Left 1063072591 10:2680927-2680949 CCTCAGATAAGCATGTCCGTTTG No data
Right 1063072595 10:2680954-2680976 CGTCCACACAGGCAGCTGCAAGG No data
1063072590_1063072595 5 Left 1063072590 10:2680926-2680948 CCCTCAGATAAGCATGTCCGTTT No data
Right 1063072595 10:2680954-2680976 CGTCCACACAGGCAGCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063072595 Original CRISPR CGTCCACACAGGCAGCTGCA AGG Intergenic
No off target data available for this crispr