ID: 1063075522

View in Genome Browser
Species Human (GRCh38)
Location 10:2712787-2712809
Sequence TGCCTCACTGCTTCCTGCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063075522_1063075529 16 Left 1063075522 10:2712787-2712809 CCCTAGCAGGAAGCAGTGAGGCA No data
Right 1063075529 10:2712826-2712848 TGGAGACATGCCTAGAGTGTTGG No data
1063075522_1063075531 25 Left 1063075522 10:2712787-2712809 CCCTAGCAGGAAGCAGTGAGGCA No data
Right 1063075531 10:2712835-2712857 GCCTAGAGTGTTGGCCTCATGGG No data
1063075522_1063075530 24 Left 1063075522 10:2712787-2712809 CCCTAGCAGGAAGCAGTGAGGCA No data
Right 1063075530 10:2712834-2712856 TGCCTAGAGTGTTGGCCTCATGG No data
1063075522_1063075528 -4 Left 1063075522 10:2712787-2712809 CCCTAGCAGGAAGCAGTGAGGCA No data
Right 1063075528 10:2712806-2712828 GGCAGGGGTGAGGAAGACAGTGG No data
1063075522_1063075533 26 Left 1063075522 10:2712787-2712809 CCCTAGCAGGAAGCAGTGAGGCA No data
Right 1063075533 10:2712836-2712858 CCTAGAGTGTTGGCCTCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063075522 Original CRISPR TGCCTCACTGCTTCCTGCTA GGG (reversed) Intergenic
No off target data available for this crispr