ID: 1063076915

View in Genome Browser
Species Human (GRCh38)
Location 10:2726245-2726267
Sequence GATGCTGATTTGACTAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063076915_1063076920 29 Left 1063076915 10:2726245-2726267 CCTGCTCTAGTCAAATCAGCATC No data
Right 1063076920 10:2726297-2726319 CACAACTAACCATCTTTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063076915 Original CRISPR GATGCTGATTTGACTAGAGC AGG (reversed) Intergenic
No off target data available for this crispr