ID: 1063079015

View in Genome Browser
Species Human (GRCh38)
Location 10:2747189-2747211
Sequence CTGACATTTCCTCCCGTACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063079011_1063079015 2 Left 1063079011 10:2747164-2747186 CCACACTCACTCCATCTCCATGT No data
Right 1063079015 10:2747189-2747211 CTGACATTTCCTCCCGTACTGGG No data
1063079012_1063079015 -9 Left 1063079012 10:2747175-2747197 CCATCTCCATGTCTCTGACATTT No data
Right 1063079015 10:2747189-2747211 CTGACATTTCCTCCCGTACTGGG No data
1063079007_1063079015 27 Left 1063079007 10:2747139-2747161 CCTTGCAGTCCCTCTGAGCGAGG No data
Right 1063079015 10:2747189-2747211 CTGACATTTCCTCCCGTACTGGG No data
1063079010_1063079015 17 Left 1063079010 10:2747149-2747171 CCTCTGAGCGAGGAGCCACACTC No data
Right 1063079015 10:2747189-2747211 CTGACATTTCCTCCCGTACTGGG No data
1063079009_1063079015 18 Left 1063079009 10:2747148-2747170 CCCTCTGAGCGAGGAGCCACACT No data
Right 1063079015 10:2747189-2747211 CTGACATTTCCTCCCGTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063079015 Original CRISPR CTGACATTTCCTCCCGTACT GGG Intergenic