ID: 1063081781

View in Genome Browser
Species Human (GRCh38)
Location 10:2774265-2774287
Sequence CAACCCACTAAGATTAATAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063081775_1063081781 21 Left 1063081775 10:2774221-2774243 CCAGCTTGCTTCAAAAATCACCT No data
Right 1063081781 10:2774265-2774287 CAACCCACTAAGATTAATAGGGG No data
1063081777_1063081781 1 Left 1063081777 10:2774241-2774263 CCTTTGCATAAGGTCATTGCCAT No data
Right 1063081781 10:2774265-2774287 CAACCCACTAAGATTAATAGGGG No data
1063081774_1063081781 22 Left 1063081774 10:2774220-2774242 CCCAGCTTGCTTCAAAAATCACC No data
Right 1063081781 10:2774265-2774287 CAACCCACTAAGATTAATAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063081781 Original CRISPR CAACCCACTAAGATTAATAG GGG Intergenic
No off target data available for this crispr