ID: 1063087565

View in Genome Browser
Species Human (GRCh38)
Location 10:2833275-2833297
Sequence CAGGAGGACAGGAGAGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063087565_1063087570 -3 Left 1063087565 10:2833275-2833297 CCTGCTTCTCTCCTGTCCTCCTG No data
Right 1063087570 10:2833295-2833317 CTGACAATCCACGCTCCACAGGG No data
1063087565_1063087573 4 Left 1063087565 10:2833275-2833297 CCTGCTTCTCTCCTGTCCTCCTG No data
Right 1063087573 10:2833302-2833324 TCCACGCTCCACAGGGAGGGAGG No data
1063087565_1063087576 30 Left 1063087565 10:2833275-2833297 CCTGCTTCTCTCCTGTCCTCCTG No data
Right 1063087576 10:2833328-2833350 CTTTAAATGAAAATTACATCTGG No data
1063087565_1063087572 1 Left 1063087565 10:2833275-2833297 CCTGCTTCTCTCCTGTCCTCCTG No data
Right 1063087572 10:2833299-2833321 CAATCCACGCTCCACAGGGAGGG No data
1063087565_1063087569 -4 Left 1063087565 10:2833275-2833297 CCTGCTTCTCTCCTGTCCTCCTG No data
Right 1063087569 10:2833294-2833316 CCTGACAATCCACGCTCCACAGG No data
1063087565_1063087571 0 Left 1063087565 10:2833275-2833297 CCTGCTTCTCTCCTGTCCTCCTG No data
Right 1063087571 10:2833298-2833320 ACAATCCACGCTCCACAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063087565 Original CRISPR CAGGAGGACAGGAGAGAAGC AGG (reversed) Intergenic
No off target data available for this crispr