ID: 1063087622

View in Genome Browser
Species Human (GRCh38)
Location 10:2833778-2833800
Sequence TTGTGGGCCACTGCATGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063087616_1063087622 23 Left 1063087616 10:2833732-2833754 CCACCACTGAAAATTAAATGCGT No data
Right 1063087622 10:2833778-2833800 TTGTGGGCCACTGCATGTCCTGG No data
1063087615_1063087622 26 Left 1063087615 10:2833729-2833751 CCTCCACCACTGAAAATTAAATG No data
Right 1063087622 10:2833778-2833800 TTGTGGGCCACTGCATGTCCTGG No data
1063087618_1063087622 20 Left 1063087618 10:2833735-2833757 CCACTGAAAATTAAATGCGTGGA No data
Right 1063087622 10:2833778-2833800 TTGTGGGCCACTGCATGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063087622 Original CRISPR TTGTGGGCCACTGCATGTCC TGG Intergenic
No off target data available for this crispr