ID: 1063087723

View in Genome Browser
Species Human (GRCh38)
Location 10:2834615-2834637
Sequence CTGAGTCAACTCGTCTATCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063087723_1063087725 6 Left 1063087723 10:2834615-2834637 CCGGGATAGACGAGTTGACTCAG No data
Right 1063087725 10:2834644-2834666 TGAAAATTTTCCTGGATTGCTGG No data
1063087723_1063087724 -2 Left 1063087723 10:2834615-2834637 CCGGGATAGACGAGTTGACTCAG No data
Right 1063087724 10:2834636-2834658 AGAATAATTGAAAATTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063087723 Original CRISPR CTGAGTCAACTCGTCTATCC CGG (reversed) Intergenic
No off target data available for this crispr