ID: 1063088096

View in Genome Browser
Species Human (GRCh38)
Location 10:2837363-2837385
Sequence CGCTGGCCTGTGGGATCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063088096_1063088101 4 Left 1063088096 10:2837363-2837385 CCAAAGGATCCCACAGGCCAGCG No data
Right 1063088101 10:2837390-2837412 GTGCTCTCCTTCCAAGCTCTCGG No data
1063088096_1063088102 5 Left 1063088096 10:2837363-2837385 CCAAAGGATCCCACAGGCCAGCG No data
Right 1063088102 10:2837391-2837413 TGCTCTCCTTCCAAGCTCTCGGG No data
1063088096_1063088105 26 Left 1063088096 10:2837363-2837385 CCAAAGGATCCCACAGGCCAGCG No data
Right 1063088105 10:2837412-2837434 GGTCTCTGCTCCCAGCACACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063088096 Original CRISPR CGCTGGCCTGTGGGATCCTT TGG (reversed) Intergenic
No off target data available for this crispr