ID: 1063089040

View in Genome Browser
Species Human (GRCh38)
Location 10:2845323-2845345
Sequence TGCAACGATCCCGATGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063089034_1063089040 11 Left 1063089034 10:2845289-2845311 CCGGAGCAGATTAAGGTGGTCAC No data
Right 1063089040 10:2845323-2845345 TGCAACGATCCCGATGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063089040 Original CRISPR TGCAACGATCCCGATGGGCT GGG Intergenic
No off target data available for this crispr