ID: 1063090204

View in Genome Browser
Species Human (GRCh38)
Location 10:2858716-2858738
Sequence GTCTGGTAGGTGATGTTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063090199_1063090204 16 Left 1063090199 10:2858677-2858699 CCTCTGTAGCTACAGTTTTCTGG No data
Right 1063090204 10:2858716-2858738 GTCTGGTAGGTGATGTTGGCAGG No data
1063090198_1063090204 27 Left 1063090198 10:2858666-2858688 CCATGGAGTCACCTCTGTAGCTA No data
Right 1063090204 10:2858716-2858738 GTCTGGTAGGTGATGTTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063090204 Original CRISPR GTCTGGTAGGTGATGTTGGC AGG Intergenic
No off target data available for this crispr