ID: 1063096368

View in Genome Browser
Species Human (GRCh38)
Location 10:2912662-2912684
Sequence CCTTCCCAGCGTACTTCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063096363_1063096368 2 Left 1063096363 10:2912637-2912659 CCCTGCTAGATGTGTCCCATTTG No data
Right 1063096368 10:2912662-2912684 CCTTCCCAGCGTACTTCTGATGG No data
1063096364_1063096368 1 Left 1063096364 10:2912638-2912660 CCTGCTAGATGTGTCCCATTTGT No data
Right 1063096368 10:2912662-2912684 CCTTCCCAGCGTACTTCTGATGG No data
1063096362_1063096368 7 Left 1063096362 10:2912632-2912654 CCTATCCCTGCTAGATGTGTCCC No data
Right 1063096368 10:2912662-2912684 CCTTCCCAGCGTACTTCTGATGG No data
1063096360_1063096368 12 Left 1063096360 10:2912627-2912649 CCTGCCCTATCCCTGCTAGATGT No data
Right 1063096368 10:2912662-2912684 CCTTCCCAGCGTACTTCTGATGG No data
1063096357_1063096368 24 Left 1063096357 10:2912615-2912637 CCTGTCCTCTGCCCTGCCCTATC No data
Right 1063096368 10:2912662-2912684 CCTTCCCAGCGTACTTCTGATGG No data
1063096359_1063096368 13 Left 1063096359 10:2912626-2912648 CCCTGCCCTATCCCTGCTAGATG No data
Right 1063096368 10:2912662-2912684 CCTTCCCAGCGTACTTCTGATGG No data
1063096361_1063096368 8 Left 1063096361 10:2912631-2912653 CCCTATCCCTGCTAGATGTGTCC No data
Right 1063096368 10:2912662-2912684 CCTTCCCAGCGTACTTCTGATGG No data
1063096358_1063096368 19 Left 1063096358 10:2912620-2912642 CCTCTGCCCTGCCCTATCCCTGC No data
Right 1063096368 10:2912662-2912684 CCTTCCCAGCGTACTTCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063096368 Original CRISPR CCTTCCCAGCGTACTTCTGA TGG Intergenic
No off target data available for this crispr