ID: 1063097084

View in Genome Browser
Species Human (GRCh38)
Location 10:2917785-2917807
Sequence TCTGATATGGAGGAGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063097084_1063097092 12 Left 1063097084 10:2917785-2917807 CCCTCTCCCTCCTCCATATCAGA No data
Right 1063097092 10:2917820-2917842 GACTGAGAGCTCCAACCCTCTGG No data
1063097084_1063097094 23 Left 1063097084 10:2917785-2917807 CCCTCTCCCTCCTCCATATCAGA No data
Right 1063097094 10:2917831-2917853 CCAACCCTCTGGTGCTGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063097084 Original CRISPR TCTGATATGGAGGAGGGAGA GGG (reversed) Intergenic
No off target data available for this crispr