ID: 1063097084 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:2917785-2917807 |
| Sequence | TCTGATATGGAGGAGGGAGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1063097084_1063097092 | 12 | Left | 1063097084 | 10:2917785-2917807 | CCCTCTCCCTCCTCCATATCAGA | No data | ||
| Right | 1063097092 | 10:2917820-2917842 | GACTGAGAGCTCCAACCCTCTGG | No data | ||||
| 1063097084_1063097094 | 23 | Left | 1063097084 | 10:2917785-2917807 | CCCTCTCCCTCCTCCATATCAGA | No data | ||
| Right | 1063097094 | 10:2917831-2917853 | CCAACCCTCTGGTGCTGCCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1063097084 | Original CRISPR | TCTGATATGGAGGAGGGAGA GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||