ID: 1063100256

View in Genome Browser
Species Human (GRCh38)
Location 10:2944353-2944375
Sequence TGTCCCCGCCGGACACCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063100256_1063100260 2 Left 1063100256 10:2944353-2944375 CCTGGTGGTGTCCGGCGGGGACA No data
Right 1063100260 10:2944378-2944400 CCACGAGATCCATCAGCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063100256 Original CRISPR TGTCCCCGCCGGACACCACC AGG (reversed) Intergenic
No off target data available for this crispr