ID: 1063100556

View in Genome Browser
Species Human (GRCh38)
Location 10:2946103-2946125
Sequence TGAGAACCAAAGATGGCGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063100556_1063100558 5 Left 1063100556 10:2946103-2946125 CCATGCGCCATCTTTGGTTCTCA No data
Right 1063100558 10:2946131-2946153 TCCACTTGTTTTTATGCTCCTGG No data
1063100556_1063100561 16 Left 1063100556 10:2946103-2946125 CCATGCGCCATCTTTGGTTCTCA No data
Right 1063100561 10:2946142-2946164 TTATGCTCCTGGATTTTAGGAGG No data
1063100556_1063100560 13 Left 1063100556 10:2946103-2946125 CCATGCGCCATCTTTGGTTCTCA No data
Right 1063100560 10:2946139-2946161 TTTTTATGCTCCTGGATTTTAGG No data
1063100556_1063100563 23 Left 1063100556 10:2946103-2946125 CCATGCGCCATCTTTGGTTCTCA No data
Right 1063100563 10:2946149-2946171 CCTGGATTTTAGGAGGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063100556 Original CRISPR TGAGAACCAAAGATGGCGCA TGG (reversed) Intergenic
No off target data available for this crispr