ID: 1063102588

View in Genome Browser
Species Human (GRCh38)
Location 10:2963333-2963355
Sequence GGCCACACACCTGGTGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063102578_1063102588 -1 Left 1063102578 10:2963311-2963333 CCACACACCTGGCCGCACACCTG No data
Right 1063102588 10:2963333-2963355 GGCCACACACCTGGTGGGGTGGG No data
1063102580_1063102588 -8 Left 1063102580 10:2963318-2963340 CCTGGCCGCACACCTGGCCACAC No data
Right 1063102588 10:2963333-2963355 GGCCACACACCTGGTGGGGTGGG No data
1063102575_1063102588 11 Left 1063102575 10:2963299-2963321 CCACACACCTGGCCACACACCTG No data
Right 1063102588 10:2963333-2963355 GGCCACACACCTGGTGGGGTGGG No data
1063102577_1063102588 4 Left 1063102577 10:2963306-2963328 CCTGGCCACACACCTGGCCGCAC No data
Right 1063102588 10:2963333-2963355 GGCCACACACCTGGTGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063102588 Original CRISPR GGCCACACACCTGGTGGGGT GGG Intergenic
No off target data available for this crispr