ID: 1063102828

View in Genome Browser
Species Human (GRCh38)
Location 10:2965327-2965349
Sequence CTGGAGACCCAGGGAAGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063102821_1063102828 3 Left 1063102821 10:2965301-2965323 CCAAAACCTGCAGGGCAGCCAGC No data
Right 1063102828 10:2965327-2965349 CTGGAGACCCAGGGAAGAACTGG No data
1063102823_1063102828 -3 Left 1063102823 10:2965307-2965329 CCTGCAGGGCAGCCAGCAGGCTG No data
Right 1063102828 10:2965327-2965349 CTGGAGACCCAGGGAAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063102828 Original CRISPR CTGGAGACCCAGGGAAGAAC TGG Intergenic
No off target data available for this crispr