ID: 1063106806

View in Genome Browser
Species Human (GRCh38)
Location 10:2999204-2999226
Sequence CTTGAGGAAGGGCTGAGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063106806_1063106816 7 Left 1063106806 10:2999204-2999226 CCCTACCTCAGCCCTTCCTCAAG No data
Right 1063106816 10:2999234-2999256 GAAAACTCCAAAATGGCTATTGG No data
1063106806_1063106814 0 Left 1063106806 10:2999204-2999226 CCCTACCTCAGCCCTTCCTCAAG No data
Right 1063106814 10:2999227-2999249 TGCCTGGGAAAACTCCAAAATGG No data
1063106806_1063106818 27 Left 1063106806 10:2999204-2999226 CCCTACCTCAGCCCTTCCTCAAG No data
Right 1063106818 10:2999254-2999276 TGGACTTACGATCAGCATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063106806 Original CRISPR CTTGAGGAAGGGCTGAGGTA GGG (reversed) Intergenic
No off target data available for this crispr