ID: 1063106814

View in Genome Browser
Species Human (GRCh38)
Location 10:2999227-2999249
Sequence TGCCTGGGAAAACTCCAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063106807_1063106814 -1 Left 1063106807 10:2999205-2999227 CCTACCTCAGCCCTTCCTCAAGT No data
Right 1063106814 10:2999227-2999249 TGCCTGGGAAAACTCCAAAATGG No data
1063106808_1063106814 -5 Left 1063106808 10:2999209-2999231 CCTCAGCCCTTCCTCAAGTGCCT No data
Right 1063106814 10:2999227-2999249 TGCCTGGGAAAACTCCAAAATGG No data
1063106806_1063106814 0 Left 1063106806 10:2999204-2999226 CCCTACCTCAGCCCTTCCTCAAG No data
Right 1063106814 10:2999227-2999249 TGCCTGGGAAAACTCCAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063106814 Original CRISPR TGCCTGGGAAAACTCCAAAA TGG Intergenic
No off target data available for this crispr