ID: 1063112231

View in Genome Browser
Species Human (GRCh38)
Location 10:3047077-3047099
Sequence TGTCTCCGGGGCTGGGAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063112215_1063112231 30 Left 1063112215 10:3047024-3047046 CCAGCATCCTTTGAGGCAGAGAG No data
Right 1063112231 10:3047077-3047099 TGTCTCCGGGGCTGGGAACCTGG No data
1063112224_1063112231 -8 Left 1063112224 10:3047062-3047084 CCATGAGGCGGGGCCTGTCTCCG No data
Right 1063112231 10:3047077-3047099 TGTCTCCGGGGCTGGGAACCTGG No data
1063112216_1063112231 23 Left 1063112216 10:3047031-3047053 CCTTTGAGGCAGAGAGATGCTAG No data
Right 1063112231 10:3047077-3047099 TGTCTCCGGGGCTGGGAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063112231 Original CRISPR TGTCTCCGGGGCTGGGAACC TGG Intergenic
No off target data available for this crispr