ID: 1063114916

View in Genome Browser
Species Human (GRCh38)
Location 10:3066864-3066886
Sequence CGCCCCAGGAGGAATCTTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063114909_1063114916 -7 Left 1063114909 10:3066848-3066870 CCGAGGCTCCCAGCGCCGCCCCA 0: 1
1: 1
2: 4
3: 38
4: 416
Right 1063114916 10:3066864-3066886 CGCCCCAGGAGGAATCTTGCGGG No data
1063114906_1063114916 0 Left 1063114906 10:3066841-3066863 CCGAGCCCCGAGGCTCCCAGCGC 0: 1
1: 0
2: 1
3: 25
4: 305
Right 1063114916 10:3066864-3066886 CGCCCCAGGAGGAATCTTGCGGG No data
1063114908_1063114916 -6 Left 1063114908 10:3066847-3066869 CCCGAGGCTCCCAGCGCCGCCCC 0: 1
1: 1
2: 2
3: 43
4: 534
Right 1063114916 10:3066864-3066886 CGCCCCAGGAGGAATCTTGCGGG No data
1063114907_1063114916 -5 Left 1063114907 10:3066846-3066868 CCCCGAGGCTCCCAGCGCCGCCC 0: 1
1: 0
2: 1
3: 41
4: 321
Right 1063114916 10:3066864-3066886 CGCCCCAGGAGGAATCTTGCGGG No data
1063114904_1063114916 23 Left 1063114904 10:3066818-3066840 CCTGGGGGCGGGGGTCGAGGAAG 0: 1
1: 0
2: 3
3: 40
4: 361
Right 1063114916 10:3066864-3066886 CGCCCCAGGAGGAATCTTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063114916 Original CRISPR CGCCCCAGGAGGAATCTTGC GGG Intronic
No off target data available for this crispr