ID: 1063115325

View in Genome Browser
Species Human (GRCh38)
Location 10:3068176-3068198
Sequence CGTGCGGCGGAGTTGGGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063115325_1063115341 12 Left 1063115325 10:3068176-3068198 CCGCCCCCCAACTCCGCCGCACG No data
Right 1063115341 10:3068211-3068233 ATGTCGAGGAAGAAACGGCTGGG No data
1063115325_1063115340 11 Left 1063115325 10:3068176-3068198 CCGCCCCCCAACTCCGCCGCACG No data
Right 1063115340 10:3068210-3068232 AATGTCGAGGAAGAAACGGCTGG No data
1063115325_1063115333 -2 Left 1063115325 10:3068176-3068198 CCGCCCCCCAACTCCGCCGCACG No data
Right 1063115333 10:3068197-3068219 CGCCACCCCCTAGAATGTCGAGG No data
1063115325_1063115339 7 Left 1063115325 10:3068176-3068198 CCGCCCCCCAACTCCGCCGCACG No data
Right 1063115339 10:3068206-3068228 CTAGAATGTCGAGGAAGAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063115325 Original CRISPR CGTGCGGCGGAGTTGGGGGG CGG (reversed) Intronic