ID: 1063115333

View in Genome Browser
Species Human (GRCh38)
Location 10:3068197-3068219
Sequence CGCCACCCCCTAGAATGTCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063115324_1063115333 -1 Left 1063115324 10:3068175-3068197 CCCGCCCCCCAACTCCGCCGCAC 0: 1
1: 0
2: 1
3: 40
4: 394
Right 1063115333 10:3068197-3068219 CGCCACCCCCTAGAATGTCGAGG No data
1063115323_1063115333 0 Left 1063115323 10:3068174-3068196 CCCCGCCCCCCAACTCCGCCGCA 0: 1
1: 0
2: 3
3: 28
4: 399
Right 1063115333 10:3068197-3068219 CGCCACCCCCTAGAATGTCGAGG No data
1063115321_1063115333 2 Left 1063115321 10:3068172-3068194 CCCCCCGCCCCCCAACTCCGCCG No data
Right 1063115333 10:3068197-3068219 CGCCACCCCCTAGAATGTCGAGG No data
1063115325_1063115333 -2 Left 1063115325 10:3068176-3068198 CCGCCCCCCAACTCCGCCGCACG 0: 1
1: 0
2: 0
3: 25
4: 315
Right 1063115333 10:3068197-3068219 CGCCACCCCCTAGAATGTCGAGG No data
1063115319_1063115333 11 Left 1063115319 10:3068163-3068185 CCTAAGTGCCCCCCCGCCCCCCA No data
Right 1063115333 10:3068197-3068219 CGCCACCCCCTAGAATGTCGAGG No data
1063115329_1063115333 -8 Left 1063115329 10:3068182-3068204 CCCAACTCCGCCGCACGCCACCC No data
Right 1063115333 10:3068197-3068219 CGCCACCCCCTAGAATGTCGAGG No data
1063115328_1063115333 -7 Left 1063115328 10:3068181-3068203 CCCCAACTCCGCCGCACGCCACC 0: 1
1: 0
2: 0
3: 7
4: 164
Right 1063115333 10:3068197-3068219 CGCCACCCCCTAGAATGTCGAGG No data
1063115322_1063115333 1 Left 1063115322 10:3068173-3068195 CCCCCGCCCCCCAACTCCGCCGC 0: 1
1: 0
2: 8
3: 100
4: 965
Right 1063115333 10:3068197-3068219 CGCCACCCCCTAGAATGTCGAGG No data
1063115326_1063115333 -5 Left 1063115326 10:3068179-3068201 CCCCCCAACTCCGCCGCACGCCA 0: 1
1: 0
2: 0
3: 14
4: 211
Right 1063115333 10:3068197-3068219 CGCCACCCCCTAGAATGTCGAGG No data
1063115330_1063115333 -9 Left 1063115330 10:3068183-3068205 CCAACTCCGCCGCACGCCACCCC No data
Right 1063115333 10:3068197-3068219 CGCCACCCCCTAGAATGTCGAGG No data
1063115320_1063115333 3 Left 1063115320 10:3068171-3068193 CCCCCCCGCCCCCCAACTCCGCC 0: 1
1: 2
2: 15
3: 200
4: 1821
Right 1063115333 10:3068197-3068219 CGCCACCCCCTAGAATGTCGAGG No data
1063115327_1063115333 -6 Left 1063115327 10:3068180-3068202 CCCCCAACTCCGCCGCACGCCAC 0: 1
1: 0
2: 0
3: 14
4: 168
Right 1063115333 10:3068197-3068219 CGCCACCCCCTAGAATGTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063115333 Original CRISPR CGCCACCCCCTAGAATGTCG AGG Intronic
No off target data available for this crispr