ID: 1063115418

View in Genome Browser
Species Human (GRCh38)
Location 10:3068522-3068544
Sequence CGGCGCCGCGGCGCGGGCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063115407_1063115418 21 Left 1063115407 10:3068478-3068500 CCGCAGACGGGAAGGATCAGGAA No data
Right 1063115418 10:3068522-3068544 CGGCGCCGCGGCGCGGGCTCCGG No data
1063115404_1063115418 28 Left 1063115404 10:3068471-3068493 CCAGCCTCCGCAGACGGGAAGGA 0: 1
1: 0
2: 2
3: 13
4: 129
Right 1063115418 10:3068522-3068544 CGGCGCCGCGGCGCGGGCTCCGG No data
1063115405_1063115418 24 Left 1063115405 10:3068475-3068497 CCTCCGCAGACGGGAAGGATCAG 0: 1
1: 0
2: 0
3: 3
4: 78
Right 1063115418 10:3068522-3068544 CGGCGCCGCGGCGCGGGCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063115418 Original CRISPR CGGCGCCGCGGCGCGGGCTC CGG Intronic
No off target data available for this crispr