ID: 1063115440

View in Genome Browser
Species Human (GRCh38)
Location 10:3068599-3068621
Sequence CCCGGCGCGCCCGCGTCCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 69}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063115440_1063115448 11 Left 1063115440 10:3068599-3068621 CCCACGGACGCGGGCGCGCCGGG 0: 1
1: 0
2: 0
3: 10
4: 69
Right 1063115448 10:3068633-3068655 CATTGAAGAGCGGAAGGTGGCGG 0: 1
1: 0
2: 0
3: 12
4: 207
1063115440_1063115449 19 Left 1063115440 10:3068599-3068621 CCCACGGACGCGGGCGCGCCGGG 0: 1
1: 0
2: 0
3: 10
4: 69
Right 1063115449 10:3068641-3068663 AGCGGAAGGTGGCGGAGACTCGG 0: 1
1: 0
2: 0
3: 15
4: 161
1063115440_1063115447 8 Left 1063115440 10:3068599-3068621 CCCACGGACGCGGGCGCGCCGGG 0: 1
1: 0
2: 0
3: 10
4: 69
Right 1063115447 10:3068630-3068652 TAACATTGAAGAGCGGAAGGTGG 0: 1
1: 0
2: 0
3: 11
4: 96
1063115440_1063115446 5 Left 1063115440 10:3068599-3068621 CCCACGGACGCGGGCGCGCCGGG 0: 1
1: 0
2: 0
3: 10
4: 69
Right 1063115446 10:3068627-3068649 ATTTAACATTGAAGAGCGGAAGG 0: 1
1: 0
2: 0
3: 4
4: 106
1063115440_1063115450 30 Left 1063115440 10:3068599-3068621 CCCACGGACGCGGGCGCGCCGGG 0: 1
1: 0
2: 0
3: 10
4: 69
Right 1063115450 10:3068652-3068674 GCGGAGACTCGGCGCGCCCCAGG 0: 1
1: 0
2: 2
3: 14
4: 84
1063115440_1063115445 1 Left 1063115440 10:3068599-3068621 CCCACGGACGCGGGCGCGCCGGG 0: 1
1: 0
2: 0
3: 10
4: 69
Right 1063115445 10:3068623-3068645 GGATATTTAACATTGAAGAGCGG 0: 1
1: 0
2: 0
3: 17
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063115440 Original CRISPR CCCGGCGCGCCCGCGTCCGT GGG (reversed) Intronic
903420837 1:23217151-23217173 CCTGGCGCGCGCCCGTCCGAGGG + Intergenic
903883751 1:26529724-26529746 CCCGGCGCCGCCGCGCCCATTGG - Intergenic
912401472 1:109397465-109397487 CCTGCCGCGCCCGCGTCCCCCGG - Intronic
915519904 1:156436122-156436144 CCCGCCGCGCCCGCGGCCGGAGG - Intergenic
920616386 1:207496479-207496501 CTCTGCGCGCCCGGGTCCGAAGG + Intronic
922783319 1:228269979-228270001 CCCGGCGCGGCCGCGGCCGGGGG - Intronic
1062874031 10:931319-931341 CCCGCCGCGGCCGCGTCCTCCGG + Intronic
1063115440 10:3068599-3068621 CCCGGCGCGCCCGCGTCCGTGGG - Intronic
1070126504 10:73626215-73626237 GCAGGCGGGACCGCGTCCGTCGG + Intergenic
1090806592 11:130206426-130206448 CCCGGCGTCTCAGCGTCCGTTGG + Intronic
1091460806 12:642653-642675 CCCAGCCCGCCCCCCTCCGTGGG - Intronic
1101131969 12:101698403-101698425 TCCGGCCCGTCCGCGGCCGTGGG - Intronic
1103364016 12:120369340-120369362 CCCGGCGCCGCCGCCTCCGCGGG - Intergenic
1103720839 12:122974641-122974663 CCCCGCCCTCCCGCGTCCATTGG + Exonic
1103749906 12:123151292-123151314 CCCGGCTCGCCCGTGTCCTCAGG + Intergenic
1103764650 12:123271621-123271643 CCCGGCGCGCCCGCCGCCCGGGG - Exonic
1108227390 13:48303665-48303687 CCGGGCCCGCCGGCGTCTGTGGG - Intergenic
1120881452 14:89417495-89417517 CCCAGGGCGGCCGCGACCGTGGG + Intronic
1121439338 14:93939039-93939061 CCATGCGCGCGCGCGTCCCTGGG + Intronic
1122112841 14:99514081-99514103 CCCGGCCCGCCCTCAGCCGTCGG + Exonic
1122270871 14:100568034-100568056 CCCCGCGGGGCCCCGTCCGTGGG + Exonic
1202898151 14_GL000194v1_random:21798-21820 CCAGGGGCGCCAGCGTCCCTGGG + Intergenic
1128995021 15:72289344-72289366 CCAGGCGCGCCCCAGTCCCTGGG + Intronic
1136566700 16:31074673-31074695 CCCGCCGCGGGCGCGTCAGTTGG - Intronic
1138686828 16:58733713-58733735 CCCGGCCCGCCCGAGTCGGTGGG - Intronic
1139530110 16:67538546-67538568 CCCTGCGCGGCCGCGTACCTGGG - Exonic
1142111448 16:88333715-88333737 CCTCGCGGGCCCGCATCCGTGGG - Intergenic
1142114660 16:88350382-88350404 CCCGGCGCACCCACCTCCCTTGG + Intergenic
1146053298 17:29568640-29568662 CGCGCCGCCCGCGCGTCCGTTGG - Exonic
1152758923 17:82098355-82098377 CCCGGCGCGCCGCCGCCGGTGGG + Intergenic
1153565609 18:6414727-6414749 CCCCGCGCGGCGGCGGCCGTGGG + Intronic
1160454971 18:78993549-78993571 CCCACCGTGCCCACGTCCGTGGG + Exonic
1160464942 18:79068957-79068979 CCCGGCGCGCTCTGGTCCGCGGG - Intergenic
1160500866 18:79400584-79400606 CCCGGCGCGCCCGGGACCGAGGG + Intronic
1166367204 19:42283905-42283927 CCCGCCGCGCCCGCCCCCATTGG - Intronic
927943323 2:27119072-27119094 CCCGCTGCGCCCGCGGCCGGAGG + Exonic
931649411 2:64454516-64454538 CCCGGCGCGGCGGGGTACGTGGG - Exonic
935059302 2:99593817-99593839 CCCAGCGCGTCCGCGGCCGCGGG + Exonic
941096686 2:161245164-161245186 CCCGGCGCGGCCGCGGCCGGGGG - Intergenic
947549830 2:231038019-231038041 CCCGGCGCCACCGCGTCCTCTGG - Exonic
948402003 2:237691744-237691766 CCCGGAGCGCCCGCTTCCCACGG + Intronic
948645275 2:239400558-239400580 CCCGCCCCGCGCGCGGCCGTGGG - Exonic
1174607071 20:51768566-51768588 CATGGTGCGCCCGTGTCCGTCGG - Exonic
1175920228 20:62447131-62447153 CCTGGCGCGCCCTCGCCTGTGGG + Intergenic
1176550104 21:8217227-8217249 CTCGTCGCGCGCGCGTCCGCTGG + Intergenic
1176569032 21:8400262-8400284 CTCGTCGCGCGCGCGTCCGCTGG + Intergenic
1176576946 21:8444497-8444519 CTCGTCGCGCGCGCGTCCGCTGG + Intergenic
1178707605 21:34888661-34888683 CCCGTCCCGCCCGCGCCCGCTGG + Intronic
1180100107 21:45579888-45579910 CCCGGGGCACCCGCGTCCCAGGG - Intergenic
1180831089 22:18906480-18906502 CCCGCCCCGCCCGCGTACCTGGG - Exonic
1182143459 22:27982356-27982378 CTCGGTGCGCCAGTGTCCGTTGG + Exonic
1183903394 22:41022359-41022381 CCCGCCGCGCTCGCGTCCCGGGG + Intergenic
1183939522 22:41285570-41285592 CCCGGGGCCCCCGCGGGCGTGGG + Intronic
1185317575 22:50185724-50185746 CCCGGCGCTCCCGGGTCCTAAGG - Intergenic
1203254996 22_KI270733v1_random:133556-133578 CTCGTCGCGCGCGCGTCCGCTGG + Intergenic
1203263052 22_KI270733v1_random:178635-178657 CTCGTCGCGCGCGCGTCCGCTGG + Intergenic
1203281176 22_KI270734v1_random:131751-131773 CCCGCCCCGCCCGCGTACCTGGG - Intergenic
992112418 5:73508661-73508683 CACGGCGCGCCCTCTTCCGTGGG + Intergenic
995106375 5:108381468-108381490 CCCGGCGCGCCCGCCCCCGCCGG - Exonic
996329361 5:122312086-122312108 CCCCGCCCGCGCGCGCCCGTTGG + Exonic
999462910 5:151772166-151772188 CCGCGCGCGCCTGCGGCCGTTGG - Intronic
1008511970 6:52284533-52284555 CCCGGCCGGGCCGCGTCCGCAGG + Intronic
1019577680 7:1745421-1745443 CCCGCCGCCCCCGCCTCCGCCGG + Exonic
1019614895 7:1954788-1954810 CCCGGCCAGCCACCGTCCGTGGG + Intronic
1020278227 7:6637282-6637304 CCCGCCCCGCCCGCGCCCGCGGG - Intergenic
1020445173 7:8261431-8261453 CCTGGCGCGCCCGTTTCCTTTGG - Intronic
1026004830 7:66592286-66592308 CCCCGCTCGCCCGCGTCGTTCGG + Intergenic
1032074566 7:128830335-128830357 CCCGCCGCGCCCGCGGCCCCCGG - Intergenic
1033361325 7:140640687-140640709 CCCGCCGCGCGCGCTCCCGTGGG + Exonic
1035266100 7:157691003-157691025 CCCGGCGCGCACCCGGCCGGCGG + Intronic
1038540376 8:28385917-28385939 CCCCGCGCGCCCGCGGCTGTCGG - Intronic
1041059393 8:54021921-54021943 CCCGCCGCGCCCGCGTCCCCGGG - Intronic
1042040021 8:64580692-64580714 CCCAGCTCGCGCGCGTCTGTGGG + Exonic
1049719265 8:144108128-144108150 CCCCGCGCGCCCGCGCCCGCCGG + Exonic
1049752224 8:144290733-144290755 CCCAGCGCGGCCGCGGCCGAGGG + Intronic
1049843200 8:144787244-144787266 CCCCGCGCGCCCGCCCCCGCCGG + Intronic
1061242715 9:129383672-129383694 CCGGGCGCGCCCGGGTGCGCAGG - Intergenic
1203471397 Un_GL000220v1:116699-116721 CTCGTCGCGCGCGCGTCCGCTGG + Intergenic
1203479218 Un_GL000220v1:160671-160693 CTCGTCGCGCGCGCGTCCGCTGG + Intergenic
1185477739 X:425378-425400 CCCGGGGACCCCGCCTCCGTGGG - Intergenic