ID: 1063115441

View in Genome Browser
Species Human (GRCh38)
Location 10:3068599-3068621
Sequence CCCACGGACGCGGGCGCGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063115425_1063115441 22 Left 1063115425 10:3068554-3068576 CCCTGCAATGTGGAAGCTGCTCT 0: 1
1: 0
2: 1
3: 11
4: 260
Right 1063115441 10:3068599-3068621 CCCACGGACGCGGGCGCGCCGGG No data
1063115424_1063115441 26 Left 1063115424 10:3068550-3068572 CCTGCCCTGCAATGTGGAAGCTG 0: 1
1: 0
2: 2
3: 20
4: 263
Right 1063115441 10:3068599-3068621 CCCACGGACGCGGGCGCGCCGGG No data
1063115423_1063115441 27 Left 1063115423 10:3068549-3068571 CCCTGCCCTGCAATGTGGAAGCT 0: 1
1: 0
2: 3
3: 28
4: 325
Right 1063115441 10:3068599-3068621 CCCACGGACGCGGGCGCGCCGGG No data
1063115426_1063115441 21 Left 1063115426 10:3068555-3068577 CCTGCAATGTGGAAGCTGCTCTC 0: 1
1: 0
2: 0
3: 18
4: 167
Right 1063115441 10:3068599-3068621 CCCACGGACGCGGGCGCGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063115441 Original CRISPR CCCACGGACGCGGGCGCGCC GGG Intronic
No off target data available for this crispr